Pmir report luciferase vector

The AGS cells were seeded in 24-well plates, 24 h prior to transfection. On the following day, 100 ng of the pMIR-REPORT™ Luciferase vector (Life technologies, Carlsbad, MD, USA) with a wild-type UTR-pMIR reporter vector or a mutant UTR reporter with a mutated seed-binding sequence was co-transfected with 10 ng of TK-luc plasmid using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). miR-302a mimic or scramble RNA duplexes were also co-transfected (Genolution, Seoul, Korea). The cells were harvested 24–48 h later, suspended in passive lysis buffer, and the activity of the luciferase reporter was measured by the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA), following the manufacturer’s instruction. Relative luciferase expression was determined as the ratio of firefly to Renilla luciferase activity. When miR-302a was transfected, AGS cells were plated in 6-well plates, 24 h prior to transfection. On the following day, the miRNA mimic or scrambled control was transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) for 48 h.

The miR-219 seed sequence was mutated by performing PCR using FastStart Taq DNA polymerase dNTPack (Roche) on the pMIR-Report luciferase-AxSall4 3′ UTR plasmid with the following primers:
AxSall43′ UTR SDM For1:
CTGCGCACTAGTCATCGCTGTCAGTTGAGG
AxSall43′UTR SDM Rev1:
AAGCATAGTCATGGTACCCCTCTGGCCAAC
AxSall43′UTR MSDM For2:
GTTGGCCAGAGGGGTACCATGACTATGCTT AxSall43′ UTR MSDM Rev2:
GCTAGCGGCCGCGTGGTATCAAC
The bold underlined bases are non-complementary sequence located where the miR-219 seed sequence is located. The two fragments were purified and combined in a PCR reaction with AxSall43′ UTR SDM For1 primer and AxSall43′ UTR MSDM Rev2 primer. This gave one PCR fragment with the mutated miR-219 seed sequence. Both the fragment and pMIR-Report Luciferase vector (Life Technologies), were digested with SpeI and NotI (NEB) and the fragments were ligated using T4 Ligase (Promega) overnight at 4 °C. Ligation reactions were then transformed into DH5α E. coli (Invitrogen). Plasmid DNA was then isolated using a Midiprep kit (Qiagen).

IKKα 3′-UTR plasmid constructs were created to experimentally confirm the binding of let-7g to IKKα. A 236-bp segment of PCR product from the wild-type 3′-UTR containing one let-7g binding site was cloned into the Mlu I/Hind III site of the pMIR-REPORT Luciferase vector (Life Technologies). The mutant 3′-UTR was also generated by site-directed mutagenesis based on the two-step PCR megaprimer method as described previously [31 (link)]. The sequence of the mutant 3′-UTR of let-7g contains 5′-TGAAGAATAAATTCATGGAGC-3′ (the six mutated nucleotides were underscored). A construct (either wild or mutant type) and let-7g mimic were co-transfected into the HEK293 cells, and firefly and Renilla luciferase activity were measured using the Dual-Luciferase Reporter Assay (Promega) at 24 hours after transfection.

To generate a reporter vector bearing the miRNA-binding sites, the putative miR-574-3p recognition sequence in the 3’-UTR region of the ERH mRNA was synthesized with four repetitions and inserted downstream of the firefly luciferase gene in the pMIR-REPORT Luciferase vector (Life Technologies), as described previously [71 (link)]. Briefly, the oligonucleotides sequences were designed to carry the MluI and SpeI sites in the multicloning site of the pMIR-REPORT Luciferase vector. The oligonucleotides used in these studies were as follows: 5′-CTAGTCACAGGTGTGTACAGC GTGCCACAGGTGTGTACAGCGTGCCACAGGTGTGTACAGCGTGCCACAGGTGTGTACAGCGTGCGCTGAGCA-3′ and 5′-CGCGTGCTCAGCGCACGCTGTACACACCTGTGGCACGCTGTA CACACCTGTGGCACGCTGTACACACCTGTGGCACGCTGTACACACCTGTGA-3′. A BlpI site (underlined) was added to each insert to test for positive clones.