Cells were lysed with TRIzol reagent, and the total RNA was extracted. The RNA purity was determined by using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). The amount of RNA used to reverse transcribe 20 μL of cDNA was 1 μg. The reverse transcription (Eppendorf AG, Germany) program settings were 42°C for 60 minutes and 70°C for 15 min. The mRNA expression was detected by using a qRT-PCR instrument (QIAGEN, Hilden, Germany) with the following program settings: 95°C for 2 min, 40 cycles at 95°C for 5 seconds, and 60°C for 34 seconds. β-Actin was used as internal control. Data were obtained as Ct values, and the 2−ΔCt method was used in the analysis. Gene expression was quantified using a relative method. Table 2 shows the primer sequences used.
Qrt pcr instrument
Manufactured by Qiagen
Sourced in Germany
The QRT-PCR instrument is a laboratory equipment used for quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis. It is designed to perform highly sensitive and accurate real-time PCR amplification and detection of nucleic acid sequences.
Automatically generated - may contain errors
Lab products found in correlation
Agilent 2100 bioanalyzer, by Agilent Technologies (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Mircute mirna isolation kit, by Tiangen Biotech (1 mentions)
Mircute plus microrna first strand cdna kit, by Tiangen Biotech (1 mentions)
Mircute plus microrna sybr green qpcr kit, by Tiangen Biotech (1 mentions)
4 protocols using qrt pcr instrument
1
Quantitative RNA Expression Analysis
2
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted using TRIzol (Invitrogen, CA, USA). First-strand cDNA was produced based on the RNA template (1 µg) using the RevertAid First Strand cDNA Synthesis Kit (ThermoScientific, CA, USA). Reverse transcription was performed at 42℃ for 60 min and then at 70℃ for a quarter. PCR amplification was conducted using the qRT-PCR instrument (QIAGEN, Hilden, Germany) at the following program settings: 95℃ for 3–5 min, followed by 40–45 cycles of 95℃ for 10 s, 50–60℃ for 30 s, and 72℃ for 40 s. GAPDH or β-actin was used as the internal control. The data were collected as CT values, which were calculated using the 2−ΔCt method or the 2−ΔΔCt method. The primer sequences are provided in Supplementary Table 1 .
3
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed with TRIzol reagent and the total RNA was extracted. RNA purity was determined by using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). The amount of RNA used to reverse transcribe 20μL of cDNA was 1μg. The reverse transcription (Eppendorf AG, Germany) program settings were 42°C for 60 mins and 70°C for 15 mins. The mRNA expression was detected by using a qRT-PCR instrument (QIAGEN, Hilden, Germany) with the following program settings: 95°C for 3 mins, 45 cycles at 95°C for 10 s, and 60°C for 30 s. GAPDH was used as an internal control. Data were obtained as Ct values, and the 2- ΔΔ Ct(ΔΔ Ct = single sampleΔCt – averageΔCt of all samples in this group; ΔCt = single target gene Ct – single sample GAPDH Ct)method was used in the analysis. Gene expression was quantified using a relative method. Table 1 shows the primer sequences used.
Primer Sequences
| Primer | Sequences (5ʹ→3ʹ) | Fragment | |
|---|---|---|---|
| Human | Human-PPARγ-F | AGCCTGCGAAAGCCTTTTGGTG | 152 bp |
| Human-PPARγ-R | GGCTTCACATTCAGCAAACCTGG | ||
| Human-VEGFA-F | TTGCCTTGCTGCTCTACCTCCA | 126 bp | |
| Human-VEGFA-R | GATGGCAGTAGCTGCGCTGATA | ||
| Human-Vimentin-F | AGTCCACTGAGTACCGGAGAC | 98 bp | |
| Human- Vimentin-R | CATTTCACGCATCTGGCGTTC | ||
| Human-GAPDH-F | GGAGCGAGATCCCTCCAAAAT | 197 bp | |
| Human-GAPDH-R | GGCTGTTGTCATACTTCTCATGG | ||
| Interference fragment | PPARγ-homo-756 | GCGGAGAUCUCCAGUGAUATT | |
| UAUCACUGGAGAUCUCCGCTT |
4
miR-4431 Expression Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miR‐4431 was extracted using the miRcute miRNA isolation kit (cat# DP503; TianGen, Beijing, China). The miRcute Plus microRNA first strand cDNA kit (cat# KR211; TianGen, Beijing, China) was used for reverse transcription of miRNA first chain cDNA, and the miRcute Plus microRNA SYBR Green qPCR Kit (cat# FP401; TianGen) was used to detect the expression of microRNA. U6 was used as an internal reference to calculate the relative expression of miR‐4431. The hsa‐miR‐4431 sequence is presented in Table S1 .
Total RNA was extracted from cells using TRIZOL reagent (cat# 15596‐026; Life Technologies, California, USA), and reverse transcription was performed at 42°C for 60 min and then at 70°C for 15 min. PCR amplification was performed using a qRT‐PCR instrument (Qiagen, Hilden, Germany) with the following program settings: 95°C for 3–5 min, 40–45 cycles at 95°C for 10 s, 50–60°C for 30 s, and 72°C for 40 s. GAPDH was used for standardization. The primer sequences are listed in TableS2 .
Total RNA was extracted from cells using TRIZOL reagent (cat# 15596‐026; Life Technologies, California, USA), and reverse transcription was performed at 42°C for 60 min and then at 70°C for 15 min. PCR amplification was performed using a qRT‐PCR instrument (Qiagen, Hilden, Germany) with the following program settings: 95°C for 3–5 min, 40–45 cycles at 95°C for 10 s, 50–60°C for 30 s, and 72°C for 40 s. GAPDH was used for standardization. The primer sequences are listed in Table
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!