Ez rt pcr core reagents

HMVEC-d and HUVEC cells were infected with KSHV (30 DNA copies/cell) for 2 h at 37°C, washed twice with HBSS, treated with 0.25% trypsin-EDTA for 5 min at 37°C to remove the bound but noninternalized virus. After 48h, cells were washed, treated with DNAse I for 10 min at 37°C, washed, total RNA was extracted from cell lysates using an RNeasy kit (QIAGEN), quantified and subjected to one step real-time RT-PCR (EZ RT-PCR core reagents, Applied Biosystems, Branchburg, NJ) for the ORF73 gene using gene specific primers and TaqMan probes as described previously [36 (link)]. A standard curve was derived using the Ct values for different dilutions of in vitro transcribed transcripts to obtain the relative copy numbers of the transcripts [36 (link)]. The expression levels of ORF73 were normalized to GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene expression.

To quantify KSHV gene expression, total RNA was extracted from mock or KSHV infected cells using an RNeasy Kit (Qiagen) according to the manufacturer's protocol. Isolated RNA was subjected to one step real time-RT-PCR using gene specific primers and Taqman probes (EZ RT-PCR core reagents, Applied Biosystems, Branchburg, NJ). The relative copy numbers of the transcripts were calculated from the standard curve, which was derived using the Ct values for different dilutions of in vitro-transcribed transcripts [54] (link). These values were normalized to each other using the values of GAPDH control reactions.

Culture growth was stopped at late exponential phase, when alpha-toxin is described to have maximal activity [23] (link), corresponding to the time-points 1) 3 hours 30 min in one group (65 strains) and 2) 4 hours 30 min in another (8 strains). Total RNA was extracted from three biological replicates. Cells were mechanically disrupted with FastPrep-24 Instrument (MP Biomedicals, Solon, OH, USA) and RNA was protected using RNA Protect (Qiagen, Valencia, USA). RNA was extracted automatically using the QIAsymphony platforms (Qiagen, Valencia, USA) with QIAsymphony RNA kit (Qiagen, Valencia, USA).
The RT-PCR assay was performed on a 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA) using the following primers and TaqMan probes: Hla RT_F: TAATGAATCCTGTCGCTAATGCC; HlaRT_R: CACCTGTTTTTACTGTAGTATTGCTTCC; Hla RT Probe: 6FAM-AAACCGGTACTACAGATAT-MGBNFQ. The RT-PCR reaction was performed using the EZ RT-PCR Core Reagents (Applied Biosystems, Foster City, USA), in which RNA is reverse transcribed and amplified in a single reaction. The following PCR protocol was used: 50°C for 2 min, 60°C for 30 min, 95°C for 5 min, followed by 42 cycles of 95°C for 20 sec and 62°C for 1 min. The 16S gene was used as internal or reference control. The primers used for 16S RNA amplification were those previously described [24] (link).