Log In Sign up
The largest database of trusted experimental protocols

35 mm glass bottom dishes

Manufactured by Cellvis
Visit Supplier
Sourced in United States, China

The 35-mm glass-bottom dishes are a type of laboratory equipment designed for cell culture applications. They feature a glass bottom that allows for optical imaging and observation of cells grown in the dish. The dishes provide a contained environment for culturing cells and support various experimental procedures.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions) Prime 95b monochrome digital camera, by Tokai Hit (2 mentions) Eclipse ti2 e, by Nikon (2 mentions) Lsm 710, by Zeiss (2 mentions) Bacmam gfp transduction control, by Thermo Fisher Scientific (1 mentions) Nucblue live readyprobes reagent, by Thermo Fisher Scientific (1 mentions) A1r hd25 confocal microscope, by Nikon (1 mentions) Hela cell line, by American Type Culture Collection (1 mentions) Dulbecco modified eagle medium (dmem), by Merck Group (1 mentions) Fugene hd, by Promega (1 mentions) Mito sypher, by Addgene (1 mentions) Hela cells ccl 2, by American Type Culture Collection (1 mentions) Mem non essential amino acids solution, by Thermo Fisher Scientific (1 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions) Deltavision omx super resolution microscope, by GE Healthcare (1 mentions) 4 6 diamidino 2 phenylindole (dapi), by Beyotime (1 mentions) H 7650, by Hitachi (1 mentions) Las x software, by Leica (1 mentions) Er tracker, by Thermo Fisher Scientific (1 mentions) Pgc 1α, by Merck Group (1 mentions)

20 protocols using 35 mm glass bottom dishes

1

EGCG Effects on FHM Cell Morphology

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cellular effect of EGCG at its safe working concentration was evaluated by fluorescence microscopy [30 (link)]. FHM cells (1.5 × 106) were cultured in 35 mm glass-bottom dishes (Cellvis, Burlington, ON, Canada) at 28 °C for 48 h and then incubated with EGCG (10 μg/mL) for 48 h at 28 °C. After incubation, the cells were washed with phosphate-buffered saline (PBS; pH 7.4) three times and subsequently dyed with fluorescein isothiocyanate-labeled anti-cytokeratin antibody. Fluorescence was observed by laser scanning confocal microscopy (LSCM, Nikon, C2, Tokyo, Japan). Untreated FHM cells served as the control group.
Cheng Y., Liu M., Yu Q., Huang S., Han S., Shi J., Wei H., Zou J, & Li P. (2023). Effect of EGCG Extracted from Green Tea against Largemouth Bass Virus Infection. Viruses, 15(1), 151.
+ Open protocol
+ Expand
2

Modulating Lipid Droplet Formation in HepG2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HepG2 cells seeded in 35-mm glass-bottom dishes (Cellvis) were fed with oleic acid (100 µM, 12 h) to induce lipid droplet formation. After brief washing, cells were cultured in fresh DMEM medium containing LY2835219 (0.5 µM) or Torin 1 (0.5 µM) without or with BFA1 (0.1 µM) to different time points. Cells were stained with BODIPY (1 µg/ml) for 30 min at 37°C before examination with confocal microscopy.
Yin Q., Jian Y., Xu M., Huang X., Wang N., Liu Z., Li Q., Li J., Zhou H., Xu L., Wang Y, & Yang C. (2020). CDK4/6 regulate lysosome biogenesis through TFEB/TFE3. The Journal of Cell Biology, 219(8), e201911036.
+ Open protocol
+ Expand
3

Live-cell Imaging of SGIV Infection

Check if the same lab product or an alternative is used in the 5 most similar protocols
For live-cell fluorescent imaging, 1 × 104 GS cells were cultured in 35-mm glass-bottom dishes (Cellvis, Hangzhou, Zhejiang, China) and infected with SGIV-Gx (MOI = 1) for 6 h. The SGIV-infected cells were then incubated with aptamer Cy5-Q5 (200 nM) at 4°C or 28°C. After the cells were washed with serum-free phenol-red-free medium, their fluorescence was detected with laser scanning confocal microscopy (LSCM; Nikon, Tokyo, Japan). Normal GS cells incubated with aptamer Cy5-Q5 (200 nM) were used as the control.
Yu Q., Liu M., Wu S., Wei X., Xiao H., Yi Y., Cheng H., Wang S., Zhang Q., Qin Q, & Li P. (2020). Specific Aptamer-Based Probe for Analyzing Biomarker MCP Entry Into Singapore Grouper Iridovirus-Infected Host Cells via Clathrin-Mediated Endocytosis. Frontiers in Microbiology, 11, 1206.
+ Open protocol
+ Expand
4

Real-Time Imaging of Anti-CD276 mAb Binding

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
We investigated the surface binding and internalization of our anti-CD276 mAb using live-cell confocal imaging following established protocols in our previous publications [29 (link),30 (link),33 (link)]. H460-Fluc and human NSCLC were cultured in 35 mm glass bottom dishes (Cellvis, Mountain View, CA, USA) at a density of 1 × 104 cells per dish in 1.5 mL of medium. To visualize the cytoplasm and nucleus, BacMam GFP Transduction Control (Invitrogen) and NucBlue™ Live ReadyProbes™ Reagent (Invitrogen), respectively, were used for staining following manufacturing protocols. Next, the AF647-labeled CD276 mAb was added to the cells at a final concentration of 1 or 5 µg per mL. Live-cell images were captured at 0–24 h after the addition of CD276 mAb-AF647 using a Nikon A1R-HD25 confocal microscope (Nikon USA, Melville, NY, USA). This experimental approach allowed us to dynamically monitor the binding and internalization of CD276 mAb into NSCLC over different time points.
Zhang J., Zhou Z.(., Chen K., Kim S., Cho I.S., Varadkar T., Baker H., Cho J.H., Zhou L, & Liu X.(. (2023). A CD276-Targeted Antibody-Drug Conjugate to Treat Non-Small Lung Cancer (NSCLC). Cells, 12(19), 2393.
+ Open protocol
+ Expand
5

HeLa Cell Fluorescence Imaging Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The HeLa cell line was purchased from ATCC. Cells were cultured at 37 °C with 5% CO2 in Dulbecco's Modified Eagle medium (DMEM; Sigma–Aldrich; St. Louis, MO, USA) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin cocktail. For fluorescence imaging experiments, cells were seeded in 35 mm glass‐bottom dishes (Cellvis, Mountain View, CA, USA). On day 2, transfection was performed when cells reached about 50–70% confluency using the Lipofectamine 3000 (Life Technologies; Carlsbad, CA, USA) reagent by following the manufacturer's instructions. 6 h post‐transfection, cells were replenished with normal DMEM. On days 3–4, transfected cells were mounted on a Nikon confocal microscope stage for imaging.
Wang T., He L., Jing J., Lan T., Hong T., Wang F., Huang Y., Ma G, & Zhou Y. (2020). Caffeine‐Operated Synthetic Modules for Chemogenetic Control of Protein Activities by Life Style. Advanced Science, 8(3), 2002148.
+ Open protocol
+ Expand
6

Mitochondrial Localization in Spheroids

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cultured MOSE cells were stained with 50 nM Mitotracker deep red (647 nm emission) prior to aggregation for 15 min followed by 2 × 5min washes with 1× PBS, and spheroids were subsequently generated as described above. Single spheroids were placed onto 35 mm glass-bottom dishes (Cellvis, Mountain View, CA, USA) for 4–8 h and then fixed with 100% methanol. To identify mitochondrial localization and prevalence, optical Z-stack slices were taken at 25× magnification using a Leica DMI8 MP inverted confocal microscope. Three-dimensional reconstruction of the spheroids was conducted using compatible LASx analysis software 2.0 to identify regional mitochondrial localization within each spheroid. Additional surface plots were generated to identify planar localizations of mitochondria.
Grieco J.P., Compton S.L., Davis G.N., Guinan J, & Schmelz E.M. (2023). Genetic and Functional Modifications Associated with Ovarian Cancer Cell Aggregation and Limited Culture Conditions. International Journal of Molecular Sciences, 24(19), 14867.
+ Open protocol
+ Expand
7

Fluorescent Imaging of SGIV-Infected Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For live cell fluorescent imaging, GS cells (1 × 105) were cultured in 35 mm glass-bottom dishes (Cellvis, Hangzhou, Zhejiang, China) and infected with SGIV (MOI = 0.5) for 0, 6, 12, 24, and 48 h. The SGIV-infected cells were incubated with aptamer Q2 (1000 nM) at 4 °C for 30 min. Hoechst 33,342 (200 uL) was added to the cells for 5 min, and cells were carefully washed three times with PBS. Serum-free phenol-red-free medium (150 uL) was added to cells, and fluorescence was detected by laser scanning confocal microscopy (LSCM; Nikon, Tokyo, Japan). SGIV-infected GS cells at 0 hpi were used as the control.
Wei H., Guo Z., Long Y., Liu M., Xiao J., Huang L., Yu Q, & Li P. (2022). Aptamer-Based High-Throughput Screening Model for Efficient Selection and Evaluation of Natural Ingredients against SGIV Infection. Viruses, 14(6), 1242.
+ Open protocol
+ Expand
8

Live-cell Imaging of DNA Stimulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were plated onto 35-mm glass bottom dishes (Cellvis) 48 h before imaging and cells were stimulated by transfection of Cy5-labeled immunostimulatory DNA. Synthetic Cy5-labeled DNA was purified by HPLC (IDT) and consisted of the following duplexed 45 bp sequence: TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA, and transfected into MCF10A TREX1 knockout cells stably expressing GFP-TREX1 by Fugene HD (Promega) according to the manufacturer’s instructions. 1 h before imaging media was replaced with fresh medium. Live-cell imaging was performed at 37°C and 5% CO2 using a Nikon Eclipse Ti2-E equipped with a CSU-W1 spinning disk with Borealis microadapter, Perfect Focus 4, motorized turret and encoded stage, polycarbonate thermal box, 5 line laser launch [405 (100 mw), 445 (45 mw), 488 (100 mw), 561 (80 mw), 640 (75 mw)], PRIME 95B Monochrome Digital Camera, and environmental enclosure (Tokai Hit) and CI Plan Apo Lambda 60x 1.40 NA. Images were acquired using NIS-Elements Advanced Research Software on a Dual Xeon Imaging workstation. Maximum intensity projection of z-stacks and adjustment of brightness and contrast were performed using FIJI software.
Zhou W., Mohr L., Maciejowski J, & Kranzusch P.J. (2021). cGAS phase separation inhibits TREX1-mediated DNA degradation and enhances cytosolic DNA sensing. Molecular cell, 81(4), 739-755.e7.
+ Open protocol
+ Expand
9

Grouper Spleen Cells SGIV Infection

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Grouper spleen cells were cultured to 100% confluence in 12-well plates or 35-mm glass-bottom dishes (Cellvis, Hangzhou, China; catalog number D35-14-1-N) at 28°C for 24 h. After the cells were infected with SGIV-Gx at a multiplicity of infection (MOI) of 1 at 28°C for 6 h, they were then washed with phosphate-buffered saline (PBS: 10 mM Na2HPO4⋅12H2O, 2 mM KH2PO4, 137 mM NaCl, 1% NaN3) and collected for further use (Yu et al., 2019a (link)).
Yu Q., Liu M., Wu S., Wei X., Xiao H., Yi Y., Cheng H., Wang S., Zhang Q., Qin Q, & Li P. (2020). Specific Aptamer-Based Probe for Analyzing Biomarker MCP Entry Into Singapore Grouper Iridovirus-Infected Host Cells via Clathrin-Mediated Endocytosis. Frontiers in Microbiology, 11, 1206.
+ Open protocol
+ Expand
10

Multiparametric Live-Cell Imaging

Check if the same lab product or an alternative is used in the 5 most similar protocols
ΔΨ, matrix pH, cytoplasmic pH, matrix H2O2, NAD(P)H levels were assessed by imaging TMRM, mito-SypHer (Addgene 48251), cyto-SypHer (Addgene 48250), mito-roGFP2-Orp1 (Addgene 64992), and NAD(P)H autofluorescence, respectively. The same imaging setup as above was used, with the exception that Zeiss filter set 20 (ex: 546/12 nm; bs: 560 nm; em: 575-640 nm) was used for TMRM, the following filter combination used for ratiometric measurements of SypHer and roGFP2-Orp1: (ex: 390-420 nm or 470/40 nm; bs: 495 nm; em: 535/30 nm), and Zeiss filter set 49 for NAD(P)H autofluorescence (ex: G365 nm; bs: 395 nm; em: 445/50). For ΔΨ, cells seeded in 35-mm glass-bottom dishes (Cellvis) were incubated with 40 nM TMRM in TS for 30 min at 37 °C. Cells were then washed with TS and imaged within 3 min at 25 °C. The TMRM fluorescence reading was normalized to the reading after adding FCCP to dissipate ΔΨ. For SypHer and roGFP2-Orp1, cells were transfected using 1.5 μg DNA/6-well and seeded into 35-mm glass-bottom dishes for imaging at 25 °C. Background subtracted fluorescence signals were processed using ImageJ. In each repeat, ~20 ROIs, each containing a single cell, were selected to obtain the average for that particular repeat.
Tsai C.W., Rodriguez M.X., Van Keuren A.M., Phillips C.B., Shushunov H.M., Lee J.E., Garcia A.M., Ambardekar A.V., Cleveland JC J.r., Reisz J.A., Proenza C., Chatfield K.C, & Tsai M.F. (2022). Mechanisms and significance of tissue-specific MICU regulation of the mitochondrial calcium uniporter complex. Molecular cell, 82(19), 3661-3676.e8.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!