Anti c myc n 262

Chromatin assays were performed as described.^{46 (link)} In brief, 1 × 10⁶ cells were cross-linked using formaldehyde to a final concentration of 1% and the reaction was stopped by adding 0.125M Glycine. Cell pellet was resuspended in Cell Lysis Buffer and after 6000 r.p.m. centrifugation RIPA buffer were added to perform nuclei lysis. DNA shearing was conducted by sonication using Bioruptor (Diagenode, Serainge, Belgium). A small aliquot of sonicated material was put aside and remaining sample immunoprecipitated using 5 micrograms of following antibodies: anti-c-Myc (N262) and anti-MYCN (B8.4.B) from Santa Cruz. Rec-sepharose Protein A or G beads (Invitrogen) were used to immobilize immunocomplexes and after RNAse-A treatment (37 °C 1 h) reverse cross-linking were performed using Proteinase K (Roche) for 6 h at 65 °C. Immunoprecipitated DNA was purified using Phenol/Chloroform and Ethanol precipitation techniques. DNA was analyzed by qPCR using the following primers: GGTTGACCCTTCGAGACAAG and CAACCGGAGGAACCTTGAT.

The WB procedure was performed as described previously
[39 (link)] with some modifications. Briefly, after transient transfection with plasmids, cells were harvested and lysed in a lysis buffer containing a cocktail of protease inhibitors. After centrifugation at 12,000 rpm for 15 min at 4°C, supernatants were collected, mixed with dithiothreitol, and used for WB. The ProteoExtract® Subcellular Proteome Extraction Kit (Millipore) was used for extraction of subcellular fractions following the manufacturer’s protocol. Equal amounts of protein extract were electrophoresed in 10% SDS-PAGE gels and then transferred to nitrocellulose membranes. The membranes were blocked with 5% bovine serum albumin (BSA) at room temperature (RT) for 1 h, incubated with the primary antibody overnight at 4°C, and incubated with the secondary antibody at room temperature for 1 h. Blots were washed in Tris-buffered saline with 0.1% Tween-20 and proteins were visualized by chemiluminescence. The following antibodies were used for WB: anti-SOX1 (IB 1:2000, Epitomics, CA, USA), anti-CK19 (1:8000, Epitomics), anti-CK18 (1:4000, Epitomics), anti-CK13 (1:4000, Epitomics), anti-CK8 (1:4000, Epitomics), anti-Involucrin (1:4000, Abcam, MA, USA), anti-GAPDH (1:10000, ProteinTec Group, IL, USA), anti-c-Myc (N-262) (1:2000, Santa Cruz Biotechnology, CA, USA), and anti-β-catenin (1:2000, Upstate, NY, USA).

For immunolabeling and protein biochemical methods, the following antibodies have been used: anti-TRIM32-3150 (Gramsch Laboratories), anti-TRIM32-3149 (Gramsch Laboratories), anti-TRIM32-M09 (Abnova), anti-TRIM32-GS (Genescript), anti-TRIM32-1137 (Gramsch Laboratories) [13 (link), 18 (link)–20 (link)], anti-USP7 (Novus Biologicals), anti-c-Myc N-262 (Santa Cruz), anti-mono-and-polyubiquitinylated conjugates (FK2) (Enzo Life Sciences), anti-FLAG M2 (Sigma), anti-enhanced green fluorescent protein (anti-EGFP) (Abcam), anti-α-Tubulin (Sigma-Aldrich), anti-Ki67 (BD Biosciences), anti-Mash1 (BD Biosciences), anti-Nestin (BD Biosciences), anti-Tuj1 (BioLegend), anti-Doublecortin X (Millipore), anti-Neuronal Nuclei (anti-NeuN) (Millipore) and anti-GFAP (Millipore). As secondary antibodies Alexa-fluorophore-conjugated antibodies (Invitrogen) were used for immunofluorescence stainings and horseradish peroxidase-coupled antibodies (GE Healthcare) for immunoblotting. DNA was counterstained using Hoechst 33258 (Invitrogen).
The following plasmids were used: pEGFP-N1 (Clontech Laboratories), pcDNA3-GFP-TRIM32 (kindly provided by Dr. Germana Meroni), pEGFP-TRIM32-ΔRING [14 (link)], pcDNA3-c-Myc (kindly provided by Dr. Martin Eilers), pBSK-HA-Ubiquitin (kindly provided by Dirk Bohrmann), pQFlag-USP7-WT-puroR and pQFlag-USP7-CS-puroR (kindly provided by Dr. Goedele Maertens).