Mastercycler nexus gx2

Total RNA was isolated using Vivantis GF-1 Total RNA Extraction Kit (Vivantis Technologies, Malaysia) according to the manufacturer's protocol. One µg of RNA was converted to cDNA with the Mastercycler Nexus GX2 (Eppendorf, Germany) using iScript cDNA Synthesis Kit (Bio-Rad, CA) according to the manufacturer's protocol. Quantitative PCR reaction was prepared using SsoFast Evagreen (Bio-Rad, CA, USA) in conjunction with specific primers as follows: CCL20 forward 5'-CAA CTT TGA CTG CTG TCT TGG AT-3' and reverse 3'-ACT TTT TTA CTG AGG AGA CGC AC-5', CCR6 forward 5'-TGC TCT ACG CTT TTA TTG GG-3' and reverse 3'-TTG TCG TTA TCT GCG GTC TC-5' and GAPDH forward 5'-GTG GAC CTG ACC TGC CGT CT-3' and reverse 3'-TGT CGC TGT GGG TGA GGA GG-5'. The reaction was performed through CFX96 Real-Time Thermocycler detection system (Bio-Rad, CA) including initial denaturation at 95 °C for 30 seconds, followed by 40 cycles of denaturation at 95 °C for 30 seconds and annealing/extension at 60 °C for 5 seconds. Melt curve analysis was performed at 65 °C to 95 °C. Relative quantitative expression is calculated by means of fold change (∆Ct) after normalizing with the reference gene GAPDH. The experiment was carried out in three independent sets.

DNA samples were genotyped with 15 microsatellite markers designed for European lobster, following the protocol outlined in Ellis et al. (2015a) (link) where 12 microsatellites from André and Knutsen (2010) (link) and 3 microsatellites from Ellis et al. (2015a) (link) were combined in three multiplex reactions (Table 1 and Supplementary Table 1). On an Eppendorf Mastercycler Nexus Gx2 thermal cycler, microsatellites were amplified in 10 μL reactions with a 10 ng DNA template using the Multiplex PCR kit (Qiagen, Germany). Final concentrations of 0.2 μM were uniformly set for all primers. For all multiplex PCRs, the same protocol was used with the following steps: initial denaturation at 95°C for 5 min, followed by 26 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 90 s, and elongation at 72°C for 30 s; and the final elongation at 60°C for 30 min. Genotyping was performed on an ABI 3730 (Applied Biosystems) DNA sequencer with an internal size standard 500 LIZ dye Size Standard (Applied Biosystems). Genemapper v.3.5 (Applied Biosystems) was used to call allele sizes.

Total RNA was purified from HeLa and HCT116 cells using TRI reagent (Sigma-Aldrich) according to manufacturer’s instructions. Single-stranded cDNA was reverse transcribed from 1 μg of total RNA using high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific) according to manufacturer’s instruction. One microliter of the RT reaction product was mixed with 1x DreamTaq PCR master mix (Thermo Fisher Scientific) and 0.5 μM of each primer in a total reaction volume of 20 μL. The primers used were as follows: 1) human cyclin F: forward – ^5’CCAGGGAACCTGAAGCTCTTT^3’ and reverse – ^5’TCGCTTTCCCAGAGGAGGTA^3’: 2) human RPL35A: forward – ^5'GGGTACAGCATCACTCGGA^3' and reverse – ^5'ACGCCCGAGATGAAACAG^3'. PCR cycles were carried out using the Eppendorf Mastercycler Nexus GX2. The PCR products were analyzed by electrophoresis in 1 % agarose gels and visualized by staining with ethidium bromide. RPL35A expression was used for normalization.

For each analysis, chromosomal DNA was isolated from 100 to 120 mg mouse faeces, using the Fast DNA SPIN kit for faeces (MP). Amplification of 16S rDNA was performed using oligonucleotide primers 16F8 and 16R1541, which corresponded to bacterial 16S rRNA gene conserved sequences (from positions 8 to 1541 on the E. coli 16S rRNA). The PCR conditions used were: DNA (50 ng); annealing at 60 °C (20 s), polymerization at 72 °C (30 s) and denaturation at 94 °C (20 s). Amplification reactions (30 cycles) were carried out in a Mastercycler Nexus GX2 (Eppendorf). Resulting DNA fragments were then sequenced.

We prepared two sets of modified double stranded oligos (dsOligos) with a thiol group in the 5′ end of the forward sequence, and a 5′ phosphate in the reverse complementary sequence (IDT, Inc.). Both dsOligos shared the same thiol-modified forward sequence: 5′-Thiol-GTTACGCCTATTCCTATCATATGAAGACA. However, the reverse complementary sequence had unique, non-palindromic 5′ overhangs (underlined) referred as RS1 (5′-Phosphate- CGGAGTGTCTTCATATGATAGGAATAGGCGTAAC) and RS2 (5′-Phosphate-CGACGTGTCTTCATATGATAGGAATAGGCGTAAC) for restriction sites 1 and 2, respectively.
Thiol- and phosphate-modified oligos were dissolved in annealing buffer (10 mM Tris, 10 mM EDTA, 50 mM NaCl, pH 7.4) and annealed (95 °C to 4 °C, 1 °C/min) in a Mastercycler Nexus GX2 (Eppendorf). The thiol groups of the dsOligos were deprotected in 0.17 M sodium phosphate (pH 8.0) with 40 mM dithiothreitol (DTT) overnight at 37 °C. The next day, deprotected dsOligos were purified using an Amersham PD-10 column. The purified dsOligos were concentrated by ethanol precipitation, dissolved in annealing buffer, and store at −20 °C with 40 mM DTT. A typical concentration of dsOligos was 2 mM.

Total RNA was collected from the cells using Ultrapure RNA Kit (Cwbio, CW0581S) and reverse transcribed to cDNA by PrimeScript™ RT reagent Kit with gDNA Eraser following the manufacturer's protocol (Takara, RR047A). 4 μL cDNA samples, 5 μL 2×UltraSYBR MixTure (Cwbio, CW0957M), 0.2 μL forward and 0.2 μL backward primers, 0.6 μL ddH₂O were mixed and centrifuged. The mixture was placed in Gradient thermal cycler (Eppendorf, Mastercycler nexus GX2), pre-denatured at 95 °C for 10 min, and run with '95 °C for 10 sec, 60 °C for 1 min, 72 °C for 20 sec' for 40 cycles.