The 16S-23S rRNA gene primers [18 (link)] were used for the molecular confirmation of the S. aureus isolates. The sequences of the primers are G1 (5′-GAAGTCGTAACAAGG-3′) and L1 (5′-CAAGGCATCCACCGT). The PCR reaction was performed on 25 μl containing 20 μl 10x GoTaq mix (PROMEGA, Madison, WI USA), 1 μl primer G1 (10 μM), 1 μl primer L1 (10 μM), and 3 μl DNA. The amplification program is composed of an initial denaturation (94°C for 2 min), 30 cycles of denaturation cycles (94°C, 1 min), hybridization (50°C, 2 min), elongation (72°C, 2 min), and a final elongation (72°C, 7 min). For the classification base on the results, 2 patterns were considered different if 2 or more bands of the electropherogram differed in size.
Gotaq mix
Manufactured by Promega
Sourced in United States
GoTaq mix is a ready-to-use solution for PCR amplification. It contains Taq DNA polymerase, dNTPs, and necessary buffers and reagents for efficient DNA amplification.
Automatically generated - may contain errors
Lab products found in correlation
Ez chip chromatin immunoprecipitation kit, by Merck Group (1 mentions)
Improm 2 reverse transcription kit, by Promega (1 mentions)
Rneasy plus kit, by Qiagen (1 mentions)
Mj research ptc 200, by Bio-Rad (1 mentions)
Nucleospin plant 2 kit, by Macherey-Nagel (1 mentions)
Original ta cloning kit, by Thermo Fisher Scientific (1 mentions)
6 protocols using gotaq mix
1
Molecular Confirmation of S. aureus
2
ChIP-qPCR Assay for SIRT6 Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The EZ ChIP chromatin immunoprecipitation kit (#17–371 Sigma-Aldrich, St. Louis, MO, USA) was used according to the manufacturer’s protocol. Briefly, the cells were transfected with scrambled plasmid or SIRT6 plasmid for 48 h and treated with 1% formaldehyde to cross-link proteins to DNA. The cells were lysed with protease inhibitors, sonicated to shear DNA into fragments and incubated with antibodies against KLF10 or anti-rabbit IgG overnight. The purified DNA and input genomic DNA were analyzed using real-time PCR (RT-PCR). The primer sequences for Sirt6 were as follows: forward: 5′-TGTGTTGTCCAGAGGTGAGG, reverse: 5′-TGCAAGCCCTCTACTGATCCC. RNA was extracted using the RNeasy plus kit (QIAGEN, Hilden, Germany) after transfection. For RT-PCR, an ImPromII reverse transcription kit (A3800 Promega, Madison, WI, USA) and GoTaq Mix (M 7122, Promega) were used as recommended by the manufacturer. The primers used were SIRT6 left: TGTGTTGTCCAGAGGTGAGG, SIRT 6 right: TGCAAGCCCTCTACTGATCCC; glyceraldehyde 3-phosphate dehydrogenase (GAPDH) left: ACCCACTCCT CCACCTTTGA, GAPDH right: TGTTGCTGTAGCCAAATTCGTT.
3
Molecular Identification of Peronospora spp.
4
Chromatin Immunoprecipitation and PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Huh7 cells were collected and counted, and 4 × 106 cells per sample were fixed with formaldehyde for 10 min at room temperature, followed by the addition of glycine. Cells were then lysed with the Abcam buffer with protease inhibitors and sonicated for 1 min on ice 5 times. About 15% of the cell lysates was saved to serve as the input control, and then each sample was equally separated into 4 tubes (∼1 × 106 cells each). Each tube was rocked overnight after the addition of 2 μg anti-H3 histone, anti-USF-1, anti-SPT-5, or control IgG. Protein A beads were then added, and the samples were rocked for an additional 2 h. Reverse cross-linking was performed on DNA slurry (Abcam kit) by incubation with proteinase K for 30 min at 55°C and 10 min at 98°C followed by centrifugation. PCR was performed using Promega GoTaq mix for 30 cycles and analyzed by gel electrophoresis in a 2% agarose gel. The primers used were CAGCCCGACCCAGAGAGTCAC (forward) and CTCCGGGCCCCGCGATCC (reverse), which generated a DNA product approximately 300 bp in length. Quantification measurements were performed with ImageJ, and the results were normalized against the input control.
5
Rapid Sterilization and PCR for M. abscessus
6
Profiling DNA Methylation of lncRNA-DLEU1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA methylation status of the lncRNA‐DLEU1 promoter was assayed by sodium bisulphite methylation sequencing. Genomic DNA (200 ng) from MCF‐7 and MDA‐MB‐231 cells was modified with sodium bisulphate by using the EZ Methylation Modification Kit (Zymo Research, Orange, CA, USA) and then amplified by PCR using Go Taq mix (Promega). In silico analyses and detailed databases searches were used to predict the 5′‐CGI(s) in lncRNA‐DLEU1 gene. PCR primers were designed to amplify a CpG‐rich region spanning from −1500 to −1000 bp from the transcription start site, which contains 32 CpG sites. Bisulphite primer sequences were 5′‐GAGTTGTGGAGTAAGAATTGATAGAAATTATTAGTTA‐3′ for forward and 5′‐CAAACCC(T)GAAATCATAAATCCCTC‐3′ for reverse. Amplicons were subcloned into the pCR2.1 vector using the Original TA Cloning Kit (Invitrogen); minimum of ten clones were picked and sequenced (Generay, Shanghai, China). Percent methylation was calculated using the following formula: Number of methylated CpGs×100/total number of CpGs assessed. TRANSFAC@7.0 (Qiagen, Hilden, Germany) was used to identify transcription factor binding sites within the lncRNA‐DLEU1 promoter region.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!