The assay was performed essentially as described in [62 (link),112 (link)] with minor modifications. 2.104 BSRT7 cells that constitutively express the T7 phage DNA-dependent RNA polymerase [113 (link)] were seeded in 96-well plates and transfected the day after with 66 ng of pEMC-N (either wt or mutated) 44 ng of pEMC-(Flag/L+P) (a home-made T7-driven bicistronic construct) [58 (link)] and 90 ng of plasmid encoding for the different minigenomes mixed with the transfection reagent as indicated in the manufacturer protocol (jetPRIME Polyplus-transfection). Two days after transfection, Firefly and NanoLuc activity were measured using the Nano-Glo Dual-Luciferase Reporter Assay (Promega). The background luciferase activity from of both luciferases observed in the absence of active L protein was subtracted from the signal measured in the presence of L, and data obtained from three independent experiments were normalized to each other to level the mean signal observed for all combinations tested at the same time. The percentage of unpriming per nucleotide of the un-transcribed intergenic (UTIGR) region (%unpriming/UTIGRnt) was calculated as follow. The luciferase signals ratios were plotted in relation to the length of the UTIGR region and the equation of the exponential regression curve was calculated (y = b*ea). The %unpriming/UTIGRnt = 1-ea.
Nano glo dual luciferase reporter assay
Manufactured by Promega
Sourced in United States
The Nano-Glo Dual-Luciferase Reporter Assay is a luminescent reporter system designed to quantify the activities of two different luciferase enzymes within a single sample. It provides a sensitive, rapid, and convenient method for monitoring the expression of two reporter genes simultaneously.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (6 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions)
Cytation 3, by Agilent Technologies (3 mentions)
Hiv 1 gag p24 quantikine elisa kit, by R&D Systems (3 mentions)
Glomax navigator microplate luminometer, by Promega (2 mentions)
Passive lysis buffer (plb), by Promega (2 mentions)
Pnl2.1 vector, by Promega (2 mentions)
Lipofectamin 3000 reagent, by Thermo Fisher Scientific (1 mentions)
Pnl2.2 vector, by Promega (1 mentions)
Glomax plate reader, by Promega (1 mentions)
Lipofectamine ltx reagent, by Thermo Fisher Scientific (1 mentions)
Plus reagent, by Thermo Fisher Scientific (1 mentions)
Pnl1.1 vector, by Promega (1 mentions)
Nano glo luciferase assay system, by Promega (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Fugene hd, by Promega (1 mentions)
Varioskan lux multimode microplate reader, by Thermo Fisher Scientific (1 mentions)
Varioskan flash multimode plate reader, by Thermo Fisher Scientific (1 mentions)
Lipofectamine ltx, by Thermo Fisher Scientific (1 mentions)
Nanoluc, by Promega (1 mentions)
29 protocols using nano glo dual luciferase reporter assay
1
Quantification of Viral Transcription Termination
2
NanoLuc Reporter Assay for ARE-Mediated Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 1 kb upstream region of the IL6 gene TSS containing the WT ARE (GCTGAGTCA) or mutated ARE (AGATCTGAC) was conjugated to the translation start site of the NanoLuc gene in the pNL2.2 vector (Promega). 293T cells (2.0 × 103 cells per well) were plated in 96-well plates 24 h before transfection. The NanoLuc reporter vectors were co-transfected with pQC-FLAG-hNRF2T80R plasmid33 (link) and pcDNA3-p65 plasmid using Lipofectamin 3000 Reagent (Thermo) according to the manufacturer's protocol. After 48 h of the transfection, the luminescence was quantified and normalized using Nano-Glo Dual-Luciferase Reporter Assay (Promega).
3
SULF1 Promoter Regulation by TFCP2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 1.1 kb portion of the human SULF1 promoter containing the predicted TFCP2 binding motif (as identified through the JASPAR database) was amplified (Fwd: TAAGCAAAGCTTAAACAATCCCCCTCCCAGT; Rev: TGCTTAAAGCTTTCAGCACAGTGGTGTGTCAA) and digested with HindIII and cloned into a NanoLuc luciferase vector, pNL1.1 (Promega). The resulting plasmid was co-transfected into A375 wild-type or TFCP2C21 cells with a firefly luciferase plasmid (pGL4.53, Promega) for normalization, and cell lysate was prepared and analyzed 48 h later (Nano-Glo Dual Luciferase Reporter Assay, Promega) on a Promega GloMax plate reader.
4
Dual-Luciferase Assay for Hypoxia Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCAs were seeded onto non-coated 6-well plates (2 × 105 cells/well) in DMEM/F12 supplemented with 10% FBS and PS. After 3 days, the medium was changed to FBS-free medium. After overnight incubation, each well was transfected with a DNA mixture containing 1.25 μg of the indicated reporter plasmid and 1.25 μg of pGL4.13[luc2/SV40] Vector (Promega) encoding the firefly luciferase under the control of a SV40 promoter using Lipofectamine LTX Reagent with PLUS Reagent (Thermo Fisher Scientific). At 24 h after transfection, PCAs were transferred to hypoxic conditions (0.1% O2) or left under normoxic conditions for 24 h. Cell lysate was collected from PCAs with Passive Lysis Buffer (Promega) and stored at −80°C. NanoLuc and firefly luciferase activities were determined with Nano-Glo Dual-Luciferase Reporter Assay (Promega) and GloMax Navigator Microplate Luminometer (Promega) according to the manufacturer’s protocol. In order to correct for transfection efficiency, the NanoLuc luciferase activity was normalized to the firefly luciferase activity.
5
Evaluating SARS-CoV-2 Spike Protein Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa-Ace2 cells were plated in 96-well black wall plates at 105 cells per well and incubated at 37°C, with 5% CO2 for 24 hours. Media was then removed, and serum was added using serial dilutions. Pseudotyped virus (pCAGGS-Spike Sars-CoV2 and mutants; NL4–3-nanoluc delta env) was added to each well, and cells were returned to the incubator. After a 48-hour incubation, reporter gene expression was determined with Nano-Glo® Dual-Luciferase® Reporter Assay (Promega) following the vendor’s protocol using a luminometer (Cytation3, Biotek). We estimated the amount of RBD-binding and NTD-binding antibodies at half maximal effective concentration (EC50) for each serum sample by fitting a four-parameter log-logistic function to each dilution curve for both RBD and NTD using the drc package in R v4.0.3. For this estimation, we used the luminescence values measured in relative light units (RLU) normalized both by the values obtained with the negative controls without virus and sera and the positive controls with each corresponding virus and no sera added (Supplementary Fig. 6c ).
6
Generation and Quantification of SARS-CoV-2 Spike Pseudoviruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK-293T cells cultured with DMEM 10% FBS were transfected with a 3:2 ratio of NL4-3-nanoluc delta env plasmid as described in Mamede et al., 201331 (link) and pCAGGS-Spike SARS-CoV2 plasmid respectively. (The following reagent was produced under HHSN272201400008C and obtained through BEI Resources, NIAID, NIH: Vector pCAGGS Containing the SARS-Related Coronavirus 2, Wuhan-Hu-1 Spike Glycoprotein Receptor Binding Domain (RBD), NR-52309). Media was changed 16 h post transfection and viral particles were harvested at 48 h. Viral particles were concentrated using a 20% sucrose gradient with overnight centrifugation at 5,600 RCF at 4°C and then resuspended into fresh media to an effective 500x concentration. The concentrated Spike pseudoviruses were quantified using HIV-1 Gag p24 Quantikine ELISA Kit (R&D Systems), and the infectivity was determined using the Hela-ACE2 cells and the Nano-Glo® Dual-Luciferase® Reporter Assay (Promega) according to manufacturers standard protocol.
7
Stat3 Regulates Sox9 Expression
8
Nano-Glo Dual-Luciferase Reporter Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Nano-Glo Dual-Luciferase Reporter assay (Promega, N1610) was used to detect the expression of RPL15-NLuc mRNA. The cells suspended in 50 μL culture medium were mixed well with an equal volume of ONE-Glo EX Reagent and then transferred to C8 black Nunc 96-well plate (ThermoFisher Scientific, 446,473) at room temperature. After incubation for 3 min, the lysate was mixed with 50 μL Stop & Glo reagent (ratio of substrate to buffer in 1:100) for luminescence detection. The Varioskan™ LUX multimode microplate reader (ThermoFisher Scientific, N16044) was used to measure the relative light unit of luminescence signals. The luminescence of each well was recorded three times with 1000-ms measuring time.
9
HEK293T Transfection and Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells were cultured and transfected according to the above procedures. After 48 h, lysis and luminescence reagents from Nano-Glo Dual-Luciferase Reporter Assay (Promega) were added to the wells according to manufacturer's protocol and luminescence readout was measured on a plate reader (BMG Labtech). All statistical analysis was conducted in Microsoft Excel.
10
Transfection and Reporter Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfections were performed using Lipofectamine 2000 or Lipofectamine LTX transfection reagent (ThermoFisher Scientific) to transfect HEK293 cells or MDA-MB-231 cells, respectively, in reduced serum media. For TTP overexpression, MDA-MB-231 cells were transfected with pCR3.1-TTP plasmid or empty vector control. HuR and BIRC5 overexpression was carried out in MCF10A cells. For silencing experiments, MCF-7 cells were transfected with 100 nM of TTP siRNA. Similarly, 50 nM of HuR siRNA or BIRC5 siRNA were transfected into MDA-MB-231 cells. For reporter experiments, HEK293 cells or HEK293 Tet-On Advanced cells were seeded in 96-well plates and transfected with 25 ng of reporter alone (HEK293 cells) or co-transfected with 10 ng Tet-ON TTP inducible constructs (HEK293 Tet-ON). Induction of TTP expression was achieved with doxycycline (0.25 µM), luciferase activity was assessed 24 h after transfection using Nano-Glo® Dual-Luciferase® Reporter Assay (Promega), and detection was performed using the Varioskan Flash multimode plate reader (Thermo Fisher Scientific). For the reporter mRNA stability assay, HEK293 cells were transfected with RPS30M1-Nluc-DU reporter for 24 h then treated with ActD (5ug/ml) for 1 h, 2, 4, and 7 h followed by RNA extraction with Trizol for RT-qPCR as indicated earlier.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!