Sybr green containing pcr kit

The total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, State of California, America). cDNA synthesis, following the instructions of HiScript II Q RT SuperMix for qPCR (Vazyme R212) was performed at 50 °C for 15 min and 85 °C for 5 s. qPCR was performed using a SYBR green-containing PCR kit (Takara, Bei Jing, China). The relative gene expression was analyzed by the Comparative Cq Method (ΔΔCq). All samples were run in triplicate in each experiment. The qPCR primers are shown in Table S4. Protein was isolated using a TNTE lysis buffer, with four protease inhibitors. Additionally, the procedure refers to a previous protocol. The primary antibodies were as follows: anti-PTRF (Abcam, dilution 1:1000, ab48824, Cambridge Science park, United Kingdom), anti-FNDC3B (Proteintech Group, dilution 1:1000, 22605-1-AP, Wu Han, China), anti-ZC3H12A (Sigma-Aldrich, dilution 1:1000, SAB3500391, Saint Louis, State of Missouri, America), anti-LRRFIP1 (Santa Cruz Biotechnology, dilution 1:200, sc-101168), anti-Flag antibody (Sigma, dilution 1:4000, F7425, Saint Louis, State of Missouri, America), and anti-β-actin(Sigma, dilution 1:5000, A5441, Saint Louis, State of Missouri, America) antibodies.

Total RNA was extracted from cells using the Trizol reagent (Invitrogen) and the concentration was calculated with the NanoDrop ND-2000. For mRNA semi-quantitative PCR, 2 μg of total RNA was reverse-transcribed to cDNA with reverse transcriptase (New England Biolabs) following the manufacturer’s protocols. Real-time PCR was carried out using the SYBR-green-containing PCR kit (Takara) according to the manufacturer’s instructions. MiRNA real-time PCR was carried out as previously described^{41 (link)}. The stem loop RT PCR primer sequences were as follows: miR-214-RT-(5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTGCC-3′) miR-214-realtime-Forward-(5′-CGCCGACAGCAGGCACA-3′), U6-RT-(5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAATATG -3′), U6-realtime-Forward-(5′-GCGCGTCGTGAAGCGTTC-3′), universal-realtime-Reverse (5′-GTGCAGGGTCCGAGGT-3′); relative expression levels were normalized to those of the U6 snRNA.