Nebnext multiplex small rna library prep set for set 1 kit

Six small RNA libraries, representing 3 biological replicates from control‐ or BDNF‐treated cortical neurons, were prepared using NEBNext^® Multiplex Small RNA Library Prep Set for Illumina^® (Set 1) kit (New England BioLabs) as per manufacturer's instructions. Multiplexed small RNA libraries were sequenced for 50 cycles in a single lane of one Illumina HiSeq2000 flow cell (EMBL Heidelberg). Raw sequencing reads were trimmed from 3′ adapter (AGATCGGAAGAGCACACGTCT) and filtered according to quality using “percent = 90 and cutoff = 30” parameters of Fastx‐Toolkit for fastq data on Galaxy71 (https://usegalaxy.org/). Reads were excluded if they only contained the adapter sequence, did not contain the adapter sequence prior to trimming, or were shorter than 15 nucleotides. The remaining reads were mapped to the rat mature miRNAs (miRBase v21) using default parameters (one mismatch, 3 nt in the 3′ or 5′‐trimming variants, 3 nt in the 3′‐addition variants) of Miraligner software 72. For mature miRNA analysis, only those that are represented by at least 10 reads per million (RPM) in one of the conditions were considered. Differential expression analysis of miRNAs was performed using edgeR73, 74. Only isomiRs with at least 1 RPM in at least one of the experimental conditions were included for analysis.

For small RNA sequencing, total RNA was extracted by Trizol reagent (Invitrogen, Carlsbad, CA, USA) from the above 18 samples (9 samples of infected fish and 9 samples of control fish). The quality of the isolated RNAs was evaluated using NanoDrop Spectrometer ND-2000 (Thermo Fisher Scientific, Waltham, MA, USA) and Agilent 2100 bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). The RIN values of the 18 samples ranged from 8.6 to 10. The RNA molecules in a size range of 18–30 nt were enriched by polyacrylamide gel electrophoresis (PAGE). Then, the 3′ adapters and 5′ adapters were ligated. The ligation products were reverse transcribed and amplified by PCR. There are 12 Index Primers for producing barcoded libraries in the NEBNext^® Multiplex Small RNA Library Prep Set for Illumina^® (Set 1) kit (NEB #E7300L, NEB, Ipswich, MA, USA). For each PCR reaction, only one of the 12 Index Primers was used. The 140–160 bp PCR products were enriched to generate a cDNA library, which was sequenced using Illumina HiSeqTM 2500 Gene Denovo Biotechnology Co. (Guangzhou, China).