Rapid ligation kit

Putative in vivo phosphorylation sites on CK1δ/ε were identified from the PhosphoSite Plus database on 1 December, 2015 (www.phosphosite.org). cDNA sequences of mutant carboxyl-terminal tails were synthesized by GeneScript in a pUC57 backbone, and used to replace CK1δ wildtype sequence by EcoRV blunt ligation. cDNA were PCR amplified with primers N1073 (CCGGCAGGGCTTCTCA|TATGACTACGTGTTCGACTG) and N1075 (CATTCCACAGGGTCGA|CCACTGTGCTGGCGAATT) using Platinum Taq kit. pBABE-6Myc-CK1δ (V1250) was engineered to carry an internal NdeI cut site using site-directed mutagenesis. These were then linearized using NdeI and SalI. Linearized backbone and PCR products were resolved on agarose gel electrophoresis, excised, and purified using QiaQuick gel extraction kit. PCR products were then cloned into linearized backbones using ColdFusion cloning kit (SBI MC101B-1), at a 2:1 insert:vector molar ratio.
Constructs for transient transfections were made by cloning from the pBABE constructs into pCS2 vector. The pBABE constructs were digested with ClaI and AvrII. pCS2-EV (V513) was digested with ClaI and XbaI. Digested products were resolved on agarose gel electrophoresis. Bands of interest were then excised and purified using MN NucleoSpin Extract II kit. Ligation of vector and insert was performed using Fermentas Rapid Ligation Kit.

Plasmid DNA was isolated using GeneJet Plasmid Miniprep Kit as per instruction (Fermentas). DNA cloning and transformation procedures followed as previously described [51 (link)]. Restriction enzymes were purchased from New England Biolabs. Ligation was carried out by using Rapid Ligation Kit (Fermentas).

We designed two expression constructs encoding the SARS‐CoV2 Receptor Binding Domain (RBD) (isolate Wuhan Hu‐1) modified with a flexible linker, a SpyTag motif (Zakeri et al., 2012 (link)) and a 6xHis‐tag on the N‐ or C‐terminus, named His‐Spy‐RBD and RBD‐Spy‐His, respectively (Figure 1A). Both constructs had a SARS‐CoV2 signal peptide (SP) on their N‐terminus, and were flanked by a 5’ EcoRI and 3’ BamHI site for cloning. Both constructs were synthesized by IDT (Coralville, IA, USA) and cloned into the pIRESpuro3 vector (cat# 631619, Takara Bio, USA) using EcoRI and BamHI restriction enzymes (R0101S and R0136S, respectively, New England Biolabs) and a Rapid Ligation Kit (cat# K1423, Thermo Fisher, USA). The constructs were validated by Sanger sequencing using CMV‐F primers (GENEWIZ, South Plainfield, NJ, USA). For expected amino acid sequences, see Supplemental Information 1.