Cultures were grown in repressing and inducing media, and whole cell extracts were prepared by the bead beating method in yeast lysis buffer (25 mM Hepes-NaOH pH 7.5, 10 mM NaCl, 1 mM ethylenediaminetetraacetic acid (EDTA), 0.1% Triton X-100) containing EDTA–free complete protease inhibitor tablet (Roche). Proteins were detected by Western Blotting, probed by anti-HA antibodies (Covance) using standard methods.
Anti ha antibody
Manufactured by Fortrea
Sourced in United States
The Anti-HA antibody is a laboratory reagent used for the detection and purification of proteins tagged with the HA (Hemagglutinin) epitope. It is a highly specific and sensitive tool for immunodetection and immunoprecipitation applications.
Automatically generated - may contain errors
Lab products found in correlation
Anti flag m2 antibody, by Merck Group (5 mentions)
Anti flag antibody, by Merck Group (5 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
Protease inhibitor cocktail, by Merck Group (3 mentions)
Epr1333, by Abcam (3 mentions)
Protein g magnetic beads, by Thermo Fisher Scientific (3 mentions)
Cycloheximide (chx), by Merck Group (3 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (3 mentions)
Lsm 710 confocal microscope, by Zeiss (3 mentions)
Anti myc antibody, by Fortrea (2 mentions)
Dnase step, by Qiagen (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Anti c myc antibody 9e10, by Santa Cruz Biotechnology (2 mentions)
Blasticidin, by Thermo Fisher Scientific (2 mentions)
Puromycin, by Thermo Fisher Scientific (2 mentions)
Polybrene, by Merck Group (2 mentions)
Fluostar galaxy, by BMG Labtech (2 mentions)
Rneasy micro kit, by Qiagen (2 mentions)
Anti flag, by Merck Group (2 mentions)
Na3vo4, by Merck Group (2 mentions)
60 protocols using anti ha antibody
1
Yeast Protein Extraction and Detection
2
Quantitative ChIP-qPCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A detailed protocol for ChIP and quantitative PCR analysis can be found at http://www.mimo.unige.ch/STRUBIN_LABb.htm . Briefly, whole-cell extracts equivalent to about 2 × 108 yeast cells were immunoprecipitated with anti-HA antibodies (2 μl, #16B12, Covance), anti-H3 antibodies (1 μl, #1791, Abcam), anti-acetyl-H3K9 (2 μl, #07-352, Millipore), anti-trimethyl-H3K4 (2 μl, #07-473, Millipore) and anti-trimethyl-H3K36 (2 μl, #9050, Abcam). The recovered DNA and at least two standard dilutions of the input DNA were quantified in duplicate by real-time PCR using the KAPA SYBR FAST qPCR Kit Master Mix (2×) Universal (Kapa Biosystems) and the Biorad CFX96 Real-time PCR System. Sequences of the oligonucleotide primers are available upon request. The immunoprecipitation (IP) value for a given region was calculated as the ratio between the IP signal and the respective input DNA signal to correct for variation between different samples and primer pairs. Quantitative sequential ChIP was performed as previously described (27 (link)). All data are representative of at least two completely independent experiments. Independent biological replicates can be found in Supplementary Material.
3
Western Blotting Protein Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Yeast extracts were prepared as previously described [24 (link),58 (link)]. Following SDS-PAGE, proteins were transferred to Immobilon-P membranes (Millipore, Burlington, MA, USA). and membranes were blocked and incubated with anti-HA antibodies (1:1000 dilution, Covance, Princeton, NJ, USA) followed by anti-mouse peroxidase antibodies (1:10000 dilution, GE Healthcare). Immunoreactive proteins were visualized using ECL western blotting detection kit (GE Healthcare) and chemiluminescence was detected in a Versadoc Image System 4000 MP (Bio-Rad Hercules, CA, USA).
4
ChIP-seq analysis of TAp73α targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TAp73α was overexpressed for 24 h in H1299 and 293T cell lines (see cell transfection section for details). Cells were collected fixed in 37% formaldehyde and subjected to sonication for DNA shearing. Chromatin was sonicated (around 500 bp) and immunoprecipitated with/without 10 μL anti-HA antibodies (Covance) or 10 μL nonspecific immunoglobulin G (IgG) antibodies (Invitrogen) using the MAGnify ChIP System kit (Invitrogen). The co-immunoprecipitated DNA fragments were amplified by PCR. MDM2 was used as positive control. SAT2 was used as negative control.
ATP7A (1) Fw GGTTTCGCTTTTGTCGTGGG, Rev TGAAAAGGAACGCGTGGTCT; ATP7A (2) Fw ATACCCTTGTACTGCTTCCCAC, Rev TAGGATGAGTTCAGGTGGCG; MDM2 Fw GGTTGACTCAGCTTTTCCTCTTG, Rev GGAAAATGCATGGTTTAAATAGCC; SAT2 Fw CTGCAATCATCCAATGGTCG, Rev GATTCCATTCGGGTCCATTC.
ATP7A (1) Fw GGTTTCGCTTTTGTCGTGGG, Rev TGAAAAGGAACGCGTGGTCT; ATP7A (2) Fw ATACCCTTGTACTGCTTCCCAC, Rev TAGGATGAGTTCAGGTGGCG; MDM2 Fw GGTTGACTCAGCTTTTCCTCTTG, Rev GGAAAATGCATGGTTTAAATAGCC; SAT2 Fw CTGCAATCATCCAATGGTCG, Rev GATTCCATTCGGGTCCATTC.
5
Antibody Immunoblotting for Transcription Factors
6
Sts5 Interacts with Rad24 in Fission Yeast
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterially expressed GST and GST-Rad24 were bound to Glutathione linked sepharose beads or magnetic beads (Pierce). The beads were then mixed with fission yeast protein extract from wild type and Sts5-HA tagged strains incubated for overnight at 4°C. The beads were then washed with TRIS lysis buffer (50 mM TrisCl, PH 7.7; 150 mM NaCl; 5mM EDTA; 5% Glycerol; 1% Triton X; 1 mM PMSF; complete EDTA-free protease inhibitor cocktail tablets (Roche Applied Science)) and separated by SDS polyacrylamide gel and analyzed by western blot using mouse monoclonal Anti-HA antibodies (Covance; RRID:AB_2314672 ). To inhibit Orb6 kinase, cells were incubated with either DMSO or 50 μM 1-NA-PP1 for 15 min at 32°C.
7
Purification of Mouse VDAC1 and RNF207 Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GST-fused protein of mouse VDAC1 was expressed in XL-10 cells using the pGEX6P-1 plasmid vector (GE Healthcare) and then purified by reduced glutathione-sepharose beads (GE Healthcare). His 6 -Flag-tagged mouse RNF207 proteins including deletion mutants were expressed in Rosetta blue cells with the use of the pET30 plasmid vector (Novagen, Madison, WI) and then purified with the use of ProBond metal affinity beads (Invitrogen).
For the production of recombinant proteins in Sf9 cells, we subcloned full-length mouse Rnf207 cDNAs into pFastBac HTc with epitope tags and expressed epitope-tagged full-length mouse Rnf207 with the BAC-to-BAC system (Clontech Laboratories, Mountain View, CA). Baculovirus infections, culture and affinity purifications were performed as described previously [29] . In vitro binding assays were performed as described previously [30] 2.9. Antibodies
We used anti-FLAG M2 antibodies (Sigma), anti-HA antibodies (Covance, Princeton, NJ), anti-VDAC1 antibodies (ab14734, Abcam, Cambridge, UK), anti-GST (B-14, Santa Cruz Biotechnology, Santa Cruz, CA), anti-PARP, anti-GAPDH (Cell Signaling Technology [CST], Danvers, MA) and anti-HSP90 (BD Transduction Laboratories, San Diego, CA).
For the production of recombinant proteins in Sf9 cells, we subcloned full-length mouse Rnf207 cDNAs into pFastBac HTc with epitope tags and expressed epitope-tagged full-length mouse Rnf207 with the BAC-to-BAC system (Clontech Laboratories, Mountain View, CA). Baculovirus infections, culture and affinity purifications were performed as described previously [29] . In vitro binding assays were performed as described previously [30] 2.9. Antibodies
We used anti-FLAG M2 antibodies (Sigma), anti-HA antibodies (Covance, Princeton, NJ), anti-VDAC1 antibodies (ab14734, Abcam, Cambridge, UK), anti-GST (B-14, Santa Cruz Biotechnology, Santa Cruz, CA), anti-PARP, anti-GAPDH (Cell Signaling Technology [CST], Danvers, MA) and anti-HSP90 (BD Transduction Laboratories, San Diego, CA).
8
Co-Immunoprecipitation of Cellular Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Co-immunoprecipitation was performed using soluble cell lysates prepared with CytoBuster (Novagen), containing protease inhibitor cocktail set III (CalBiochem). The lysates were rotated overnight at 4℃ with 2 μg of anti-HA antibody (Covance) or normal mouse IgG (Jackson ImmunoResearch Laboratory). A 50 μl suspension (1 : 1) of Protein A/G-agarose beads (Pierce) was added and incubated by rotation at 4℃ for 2 h. The immunoprecipitates were pelleted by centrifugation and washed three times with the lysis buffer. Both the immunoprecipitates and total cell lysates were analyzed by anti-hSP56 and anti-HA immunoblotting. Immunoblotting and immunofluorescence analyses were described previously (14) (link).
9
Analyzing RIPK1-RIPK3 Interaction in HIV-1 Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In preparation for transfection, 1.5×106 HeLa-CD4 cells were plated onto 60-millimeter (mm)-diameter cell culture plate and grown at 37°C in the conditioned Dulbecco's modified Eagle's medium (DMEM). The cells were then co-transfected with 3 μg pcDNA3.1-RIPK1-HA and 3 μg pcDNA3.1-RIPK3-FLAG. After 6 h, cells were infected with HIIV-1 viruses at 25 ng HIV-1 p24 equivalent and then treated with DMSO or Nec-1. Three days later, cells were collected and treated with lysis buffer [150 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 1% Triton X-100, and 0.5% NP-40]. Co-immunoprecipitation and Western blotting were then performed as previously described [29] (link). The anti-HA-Agarose (sigma) antibody, anti-HA antibody (mouse monoclonal, Covance), anti-FLAG antibody (rabbit polyclonal, MBL), anti-caspase3 antibody (rabbit polyclonal, CST), and anti-tublin antibody (mouse monoclonal, abcam) were used as primary antibodies.
10
ETV1 Pull-down Assay with Biotinylated Probes
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!