Embryo max electroporation buffer

One day before electroporation, irradiated CF1 MEFs (Thermo Fisher) were seeded on 0.1% gelatin pre-coated dishes using MEF culture medium (DMEM supplemented with 10% of FBS (GenDEPOT) and 1% Penicillin/Streptomycin) at a density of 6.7 × 10⁵ cells per 100 mm dish.
To generate the H1-p53(R248W/R248W) cell line, 1 × 10⁷ H1 hESCs were re-suspended in 0.6 ml Embryo Max Electroporation Buffer (Millipore) mixed with 50 μg of TP53 R248W donor vector and 5 μg of each TALEN plasmids, and electroporated at 300 V/500 uF in the Bio-Rad Gene Pulser Xcell System. After electroporation, cells were immediately seeded on 100 mm MEF plates in hESC medium (DMEM/F12 (Corning) supplemented with 20% KnockOut Serum replacement (Life Technologies), 1% Gibco GlutaMax (Life Technologies), 1% NEAA (Corning), 0.0007% β-mercaptoethanol (Sigma) and 10 ng/ml FGF2 (EMD Millipore)) supplemented with 2 μM ROCK inhibitor Thiazovivin. After 2 days, cells were selected with 50 μg/ml G418 for 2–3 weeks and medium was changed every 2 to 3 days until colonies were big enough for picking. Individual clones were picked and expanded for further confirmation by genomic PCR as described above.

24 hours prior to electroporation, H1 hPSCs were treated with 10 µM Y-27632. On the day of electroporation, cells were split to single cells with TrypLE Express. 10 × 10⁶ H1 hPSCs were resuspended in 800 µL EmbryoMax electroporation buffer (Millipore, ES-003-D) and incubated with 40 µg CAG-GFP plasmid (Addgene plasmid #22212)+ 10 µg zinc finger nuclease plasmid (targeting the AAVS1 locus, sequences obtained from [32 (link)]) for 5 min at 4C. Cells were electroporated at 250 V, 500 µF and plated onto puromycin-resistant MEFs in hESC media (KnockOUT DMEM supplemented with 20% KnockOUT Serum Replacement, 1× Glutamax, 1× MEM NEAA, 55 µM β-ME, 10 ng/mL bFGF) and 10 µM Y-27632. 48 hours after electroporation, cells were treated with 0.5 µg/mL puromycin (Sigma-Aldrich) daily in order to select for cells that stably integrated the CAG-GFP construct. 11–14 days following the start of selection, surviving clones were monitored for GFP expression and picked onto Matrigel-coated plates. Site-specific integration was confirmed by PCR using the following primer sequences (forward primer: GCTCTACTGGCTTCTGCG; reverse primer: AGAAGACTTCCTCTGCC). One correctly integrated clone was expanded into the H1 CAG-GFP hPSC line used in this study.

A CRISPR guide targeting exon 16 of RB1 was designed using CRISPR Design website (http://crispr.mit.edu). Two sgRNAs (TTAGCAAACTTCTGAGTGAC and TTTATTGGCGTGCGCTCTTG) targeting exon 16 of RB1 gene were selected and cloned into pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)(Puro^R), respectively to generate the guide plasmids. For electroporation, 10⁷ cells were re-suspended with 0.6 ml Embryo Max Electroporation Buffer (Millipore), mixed with CRISPR/Cas9 nickase plasmids (25 μg each) and electroporated at 300 V/500 μF in a BIO-RAD Gene Pulser Xcell System. Following electroporation, cells were immediately dispensed into 10 cm MEF-coated plates in hESC medium (DMEM/F12 (Corning) with 20% KnockOut Serum replacement (Life Technologies), 1% Gibco GlutaMax (Life Technologies), 1% NEAA (Corning), 0.0007% β-mercaptoethanol (Sigma) and 10 ng/ml FGF2 (EMD Millipore)) supplemented with 10 μM ROCK inhibitor. After 48 h recovery, cells were treated with 1 μM puromycin (Sigma) for 48 h and then maintained in regular hESC medium for colony growth. The isolated genomic DNA from individual colonies was used for clonal identification by PCR using a RB1 exon 16 specific primer set (forward: 5′-TCTGTTTCAGGAAGAAGAACGAT-3′; reverse: 5′-ACCATGGAGGTTACAGCAGTG-3′). The PCR fragments of wild-type and deletion of RB1 exon 16 were examined by Sanger sequencing.

Oligo pools were amplified with primers at both ends (40ul NEBnext, 0.2-ul library, Ta=65, 30 cycles) and the 170bp band purified on a 4% agarose gel (Qiagen gel purification). Phrases were extended with homology arms (Table S1) (1000ul NEBnext, Ta = 65, 30 cycles) and purified (Qiagen minelute) to prepare for electroporation. 20 ug CBh Cas9-BlastR plasmid, 20 ug U6-gRNA-HygroR plasmid, and purified phrases were vacuum centrifuged to a final volume of <20 ul, added to 120 ml EmbryoMax Electroporation Buffer (ES-003-D, Millipore), and mixed with mESCs pelleted from a 15cm plate (~2e7 cells). This was transferred into a 0.4-cm electroporation cuvette and electroporated using a BioRad electroporator (230 V, 0.500 mF, and maximum resistance). Cells were passaged three times following integration.