Plant genomic dna kit

Genomic DNA was extracted from 7-DPA tomato fruits using a Plant Genomic DNA Kit (TIANGEN; #DP305) and sequenced on Illumina HiSeq2000 platform at Novogene (Beijing, China). For obtaining clean, high-quality data, quality control of raw data from the Illumina HiSeq 2000 platform was checked using FastQC (www.bioinformatics.babraham.ac.uk/projects/fastqc). The reads were fed into fastp v0.22.0^{32 (link)} to adapter trimming, low-quality reads removals and short-reads deletion. Next, the clean data was aligned to the tomato reference genome (SL4.0, https://solgenomics.net/ftp/genomes/Solanum_lycopersicum/assembly/build_4.00/S_lycopersicum_chromosomes.4.00.fa) and the pBI121-AGL66-FLAG vector sequence using BWA 0.7.17^{33 (link)}, respectively, to identify junction reads. Subsequently, the location information of the T-DNA insertion site was determined by the junction reads that aligned simultaneously with both the reference genome sequence and the vector sequence.

Genomic DNA of the 65 samples was extracted using the Plant Genomic DNA Kit (Tiangen Biotech, Beijing, China), following the manufacturer’s instructions. Universal primers were used for PCR amplification of ITS2, matK, trnH-psbA, rbcL and trnL-trnF. Final volume of each PCR reaction was 25ul and contained 2ul DNA template, 1ul each of forward and reverse primers, 12.5ul PCR Master Mix (2X, Tiangen Biotech, Beijing, China) and 8.5ul deionized water. Optimization and adjustments were made according to the PCR conditions reported in Table 1 [20 (link)]. The PCR products were resolved by electrophoresis on 1.5% agarose gel. All amplified products were sequenced by Guangzhou IGE Biotechnology Co., Ltd. The DNA sequencing method used the Sanger method, and DNA sequencing was performed in ABI PRISM 3730xl Genetic Analyzer (Applied Biosystems, USA).

DNA was extracted from the cultures grown on PDA for 7 days using the Plant Genomic DNA Kit (DP305, TIANGEN Biotech, Beijing, China). Polymerase chain reaction (PCR) amplifications of the internal transcribed spacer (ITS), beta-tubulin (BenA), calmodulin (CaM) and RNA polymerase II second largest subunit (RPB2) gene regions were conducted with the routine methods [21 (link),22 (link),23 (link),24 (link)]. The products were purified and subject to sequencing on an ABI 3730 DNA Sequencer (Applied Biosystems). Although the ITS region is proposed as the universal DNA barcode for fungi, it is not sufficient to distinguish species of Aspergillus. The ITS sequences provided in this study might be helpful for other researchers in case of need.

The full‐length DNA sequence of the BnF5H gene family was screened using the Genoscope Brassica napus Genome Browser (http://www.genoscope.cns.fr/brassicanapus/). Cotargeting primer gRNAs (Table S1) of the dominantly expressed BnF5H‐1, BnF5H‐4, BnF5H‐6, and BnF5H‐7 were designed using the CRISPR‐P 2.0 website (http://crispr.hzau.edu.cn/CRISPR2/). One putative target site located at the second exon of the BnF5H coding sequence was selected to design the sgRNA sequences based on their GC abundance. The sgRNA sequence was 20 bp long and was adjacent to the PAM (NGG) region, which must be located in a conserved region of the four BnF5H members simultaneously and within a functionally conserved domain. To ensure the specificity of the sgRNA sequence, BLAST was performed on the online website (http://brassicadb.org/brad/). Oligos were designed to specifically target BnF5H, and sgRNA cassettes were assembled into binary CRISPR/Cas9 vectors. Genomic DNA was isolated from the f5h mutant using a plant genomic DNA kit (TIANGEN), followed by PCR amplification using gene‐specific primers (Table S1). The BnF5H‐1, BnF5H‐4, BnF5H‐6, and BnF5H‐7 PCR products were cloned into the PEASTY‐T₁ vector (TransGen Biotech), and at least 20 clones for each mutant line were randomly selected for sequencing.

The DNA was extracted and sequenced according to the method described in Li et al. (2022) (link). Algal cell pellets were obtained by centrifuged 10 mL diatom cultures at 5,000 g for 5 min. Total DNA was extracted by using the Plant Genomic DNA Kit (Tiangen Biotech Co., Beijing, China). The small-subunit ribosomal DNA (SSU rDNA), large-subunit ribosomal DNA (LSU rDNA), chloroplast-encoded genes rbcL and psbC were amplified by polymerase chain reaction (PCR). Forward and reverse strands were amplified using the follow primes (Table 1). The PCR cycles of the four markers follow Alverson et al. (2007) (link). The PCR products were purified using TIANgel Midi Purification Kit (Tiangen Biotech Co., China) and sequenced by Tsingke Biotechnology Co.,Ltd. (Beijing, China).

The fresh leave of three cultivated varieties was frozen in liquid nitrogen and stored in a − 80 °C refrigerator for DNA extraction. DNA extraction was performed using Plant Genomic DNA Kit (Tiangen Biotech, Beijing) following the manufacturer instructions. Around 20–30 mg of dried tissue or 50–60 mg of frozen tissue was used in each extraction. After DNA isolation, 1 μg of purified DNA was fragmented and used to construct short-insert libraries (insert size 300–500 bp) according to the manufacturer’s instructions (Illumina HiSeq X-Ten) for sequencing.

The procedure of total genomic DNA isolation was followed the manual of Plant Genomic DNA Kit (TIANGEN, China). The specific primers designed from hygromycin resistance gene sequence were used for the identification of exogenous T-DNA insertion, and the primers sequence are Hyb-S2: TCGTTATGTTTATCGGCACTTTG, Hyb-A2: TATTGGGAATCCCCGAACAT. The common PCR primers of two GhMYB25-like genes were synthesized for double-cleavage mutation analyses and genes cloning, and the primers sequence are GhMYB25-like-S: TAACCAATTCTACCCACATTTTCG, GhMYB25-like-A: TGCCACTTTATCGGTTGTCGTA. PCR products were cloned by TA cloning reaction. And the positive colonies were randomly selected for sequencing (Genomics Core Facility, East Carolina University, NC). The sequences were analyzed and aligned through NCBI database and DNAman software.