Qiaxpert

Deep-frozen lungs were homogenized via cryomill (1.7 amplitude, 2–8 min, Analysette 3, Fritsch GmbH, Idar-Oberstein, Germany) with continuous usage of liquid nitrogen. For total RNA extraction 25 mg of the pulverized lungs were used. To enable proper storage conditions, RNA extraction was immediately started using the RNeasy^® kit (Qiagen, Hilden, Germany) after lung homogenization, according to the manufacturer’s recommendations. Briefly, lysis buffer was added to the frozen lung powder and the mixture was transferred to QIAshredder^TM (Qiagen, Hilden, Germany). The obtained flowthroughs were stored at −80 °C until further work-off, according to manufacturer’s recommendations. Samples were purified from remaining DNA with on-column digestion using RNase-Free DNase Set (Qiagen, Hilden, Germany). The RNA concentration was determined by spectrophotometric measurement (QIAxpert, Qiagen, Hilden, Germany) and the RNA quality was analyzed by capillarity electrophoresis (Agilent Bioanalyzer 2100-Agilent RNA 6000 Nano Kit, Cat No. 5067-1511, Agilent Scientific Instruments, Santa Clara, CA, USA). The integrity of the total RNA was assessed by visualization of intact ribosomal RNA bands.

Bacterial genomic DNA was amplified with the primers 16S_V3_F (5′-TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG CCT ACG GGN GGC WGC AG-3′) and 16S_V4_R (5′-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GGA CTA CHV GGG TAT CTA ATC C-3′), which are specific for the V3–V4 hypervariable regions of the 16S rDNA gene. The libraries were prepared using PCR products according to the MiSeq System guide (Illumina, USA) and quantified using QIAxpert (QIAGEN, Germany). Each amplicon was then quantified, set to an equimolar ratio, pooled, and sequenced on a MiSeq instrument (Illumina, USA) according to the manufacturer’s recommendations.

Bacterial genomic DNA was amplified with the 16s_V3_F (5′- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG -3′) and 16s_V4_R (5′- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC -3′) primers specific for the V3-V4 hypervariable regions of the 16s rDNA gene. The libraries were prepared using PCR products according to the MiSeq System guide (Illumina, CA, USA) and quantified using a QIAxpert (QIAGEN). Each amplicon was then quantified, set at an equimolar ratio, pooled, and sequenced with a MiSeq (Illumina) according to the manufacturer’s recommendations.

Bacterial DNA was extracted from batches of blood cells using a PowerMax Soil DNA Isolation Kit (MOBIO, Carlsbad, CA, United States) following the manufacturer’s protocol. The V3–V4 hypervariable region of bacterial genomic DNA was amplified according to Illumina 16S metagenomic sequencing library protocols (Illumina, San Diego, CA, United States). The barcoded fusion primer sequences used for amplification were 16S_V3_F (5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACG GGNGGCWGCAG-3′) and 16S_V4_R (5′-GTCTCGTGGGCT CGGAGATGTGTATAAGAGACA GGACTACHVGGGTATCT AATCC-3′). The libraries were prepared using PCR products according to the MiSeq System guide (Illumina) and quantified using a QIAxpert (QIAGEN, Hilden, Germany). After PCR products were extracted and quantified, equimolar ratios from each mixture were pooled and sequenced on the MiSeq (Illumina) platform according to the manufacturer’s recommendations.

mRNA was isolated from 60-65 mg of liver tissue stabilized with RNAlater using the QIAamp RNA Blood Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions with an elution volume of 30 μL. The tissue was disrupted using a mortar and pestle and then homogenized using a QIAshredder homogenizer. The mRNA was quantified with the QIAxpert (Qiagen, Hilden, Germany) spectrophotometer. Only samples with an A260/A280 between 1.900 and 2.000 were used for downstream analyses. mRNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany). 1 μg RNA was incubated with 1X gDNA wipe-out buffer in an 84 μL reaction for 2 min. at 42°C, followed by 2 min. cooling on ice. 41.5 μL of the incubated mixture were then added to 18 μL + RT and -RT reactions. Both these reactions contained 1X Quantiscript RT buffer and 3 μL RT primer mix. 3 μL Quantiscript reverse transcriptase was added to the +RT mix and 3 μL RNAse-free water was added to the -RT mix. The resulting 60 μL reactions were incubated for 30 min. at 42°C, followed by 3 min. at 95°C and cooling on ice.

Total RNA from blood samples was isolated as per the protocol given in the PAXgene Blood miRNA Kit Handbook (PreAnalytiX, Switzerland, Cat. No. 763134). After the collection, RNA samples were stored at −40°C until processed further. The concentration and purity of RNA was measured using Qubit 4 fluorometer (Thermo Fisher, USA) and Qiaxpert (Qiagen, USA), respectively.