Mirna isolation kit

SCC25 and SCC090 cells (2 × 10⁵ cells collected at 24 h post-transfection) or 0.15 ml plasma was mixed with 1 ml Trizol reagent (Invitrogen, USA) to extract total RNAs. Following DNase I digestion, SensiFAST™ cDNA Synthesis Kit (Bioline, USA) and KAPA SYBR® FAST Universal Kit (Sigma-Aldrich, USA) were used to perform reverse transcription and prepare qPCR reaction mixtures. The expression of NCK1-AS1 was detected with 18S rRNA as the internal control. The miRNA Isolation Kit (RMI050, Geneaid, USA) was used to extract miRNA from SCC25 and SCC090 cells (2 × 10⁵ cells collected at 24 h post-transfection) or 0.15 ml plasma. MystiCq® microRNA cDNA Synthesis Mix (Sigma-Aldrich, USA) was used to synthesize cDNA and qPCR reactions were carried out using miScript SYBR Green PCR Kit (QIAGEN, Shanghai, China). The expression of miR-100 was determined with U6 as endogenous control. Primer sequences were 5′-AGTTCAGCCCCCACTGCTCT-3′ (forward) and 5′-TGGTTTGAGTTCCCATTTCTC-3′ (reverse) for NCK1-AS1; 5′-TACCACATCCAAGGAAGCA-3′ (forward) and 5′-TTTTTCGTCACTACCTCCCC-3′ (reverse) for 18S rRNA; 5′-ATATGGAACGCTTCACGAATTT-3′ (forward) and 5′-TCGCTTCGGCAGCACATATAC-3′ (reverse) for U6. The forward primer of miR-100 was 5′-AACCCGUAGAUCCGAACUUG-3′. Poly (T) was used as the reverse primer of miR-100. Each experiment included 3 replicates. All Ct values were calculated based on the 2^−ΔΔCT method.

The levels of mRNA in cultured cells were analyzed by PCR. The total RNA was extracted using Trizol reagent (Life Technologies, Grand Island, NY, USA). The cDNAs were synthesized by MMLV HP reverse transcriptase (Epicentre, Madison, WI, USA) according to vendor's protocol. PCR reaction was done using McTaq DNA polymerase (Won-Won Biotechnology, Co. Ltd.., Taishan, New Taipei City, Taiwan), freshly prepared cDNA pools and specific primers. PCR reactions were carried out using gene-specific primers: human SDC1; 5ʹ-gctctggggatgactctgac-3ʹ and 5ʹ-gtattctcccccgaggtttc-3ʹ; human GAPDH; 5ʹ-gagtcaacggatttggtcgt-3ʹ and 5ʹ-gatctcgctcctggaagatg-3ʹ. Quantitative real-time PCR were performed using VeriQuest Fast SYBR green qPCR reagent (Affymetrix Inc., Santa Clara, CA, USA) in a StepOne Plus real-time PCR system (Thermo Fisher Scientific Inc., Pittsburgh, PA, USA). The 2^–ΔΔCT method was used to determine the relative gene expression using GAPDH as control. For PCR analysis of mature miRNA, the small RNAs were purified by miRNA isolation kit (Geneaid biotech Ltd., Shijr, NewTaipei City, Taiwan). The specific RT primer for reverse transcription of small RNAs into cDNA was listed in Supplementary Table 1. For PCR assay, the DNA segment corresponding to mature miRNA and one universal reverse primer (see Supplementary Table 1) were used as forward primer and reverse primer, respectively.

Stored sera were assessed for miR-122, miR-221 and miR-224 expressions. First, total miRNA was extracted from serum samples with miRNA Isolation Kit (Geneaid Biotech Ltd., New Taipei City, Taiwan) according to the manufacturer’s instructions. Approximately 5 μg of miRNA was then reverse-transcribed into cDNA by means of the TaqMan^® microRNA RT kit (Applied Biosystems, Foster City, CA, USA) and miRNA-specific stem-loop primers (Applied Biosystems, Foster City, CA, USA) using thermal cycler PCR conditions (pre-denaturation at 16 °C for 30 min, primer extension with the first cDNA strand synthesis at 42 °C for 30 min, and reaction termination at 85 °C for an additional 5 min).

From NanoString analysis, we selected candidate miRNAs that were significantly differential expression between cancerous and non-cancerous tissues. After filtering, the top 3 candidate miRNAs, including miR-223-3p, miR-199a-5p and miR-451a, were selected for validate their circulating expression levels by qRT-PCR analysis. Briefly, 200 μL of serum samples were extracted using a miRNA isolation kit (Cat No. RMI050, Geneaid Biotech, USA). For cDNA synthesis and poly (A) tail addition, the first-strand cDNA was then synthesized from purified total RNA using SL-poly (A) sequence: GTCGTATCCAGTGCAGGGTCCGAGGTAT TCGCACTGGATACGACAAAAAAAAAAAAAAAAAAVN and RevertAid First Strand cDNA Synthesis Kit (Cat No. 1622, Thermo Scientific, USA). The candidate miRNAs were assessed in duplicate by quantitative RT-PCR using SYBR Green system (QPCR Green Master Mix HRox, Cat No. BR0500402, Biotechrabbit, Germany) with specific primers including miR-223-3p:5’TGTCAGTTTGTCAAATACCCCA3’(forward),miR-199a5p:5’AGTGTTCAGAC TACCTGTTC3’(forward), miR-451a: 5’AAACCGTTACCATTACTGAGTT3’(forward) and SL-polyA-R: 5’GCAGGGTCCGAGGTATTCG3’ (universal reverse). MiR-21 was used as the internal control [12 (link)]. Downregulation was confirmed by StepOnePlus Real-time PCR System (Applied Biosystems, USA). The relative expression level was calculated by ΔΔCT of the 2^{- ΔΔCT} method [13 (link)].^.