Scrambled shrna shscr

shRNA oligo sequences were obtained from the RNAi Consortium (TRC, Broad Institute) and cloned into pLKO.1 vector (Addgene, #10878) according to a corresponding Addgene protocol (65 (link)). Four to five shRNAs per gene were tested for their knockdown potential and the two most efficient shRNAs were used in experiments. The non-targeting TRC2 shRNA (referred to as scrambled shRNA shScr, Sigma-Aldrich, #SCH202) was used as a negative control. For shRNA sequences see table S9. The Myc-Flag-tagged cDNA for mouse p21 was obtained from Origene (#MR227529) and subcloned into the lentiviral pTSIN-PGK-puro2 backbone (43 (link), 66 (link)) or dox-inducible pTRIPZ-PKG-puro backbone (modified from GE Dharmacon) (67 ). Similarly, the Myc-Flag-tagged cDNAs for mouse p16 (Origene, #MR227284) and mouse p27 (Origene, #MR201957) were also subcloned into the lentiviral pTSIN-PGK-puro2 backbone.

CT26 or MC38 were seeded onto 6 well-plates at a density of 5×10⁵ cells/well. The next day, cells were transfected with shIDO or shScr (1μg/well) using Lipofectamine 3000 (Thermofisher). The pLKO.1-puro lentiviral vector containing the 21-mer shRNA sense sequence CGTCTCTCTATTGGTGGAAAT (shIDO#9), pEQshIDO, or scrambled shRNA (shScr) sequence (Sigma) were used. Twenty-four hours after transfection, cells were stimulated with murine IFN-γ (100ng/ml, Peprotech) and/or TNF-α (10ng/ml, Peprotech). Forty-eight hours after IFN-γ treatment, cells were lysed in protein extraction buffer (150 mM NaCl, 10 mM Tris, 1mM EDTA, 1% NP-40, 1mM EGTA, 50 mM NaF containing protease and phosphatase inhibitor cocktail), subjected to SDS-PAGE, and subsequently transferred to PVDF membrane (Invitrogen). The membranes were probed with mouse anti-mouse IDO (05-840, Millipore; 1:500 dilution) or rabbit anti-mouse β-actin (4970, Cell Signaling; 1:1000 dilution) antibodies, followed by goat anti-mouse polyvalent immunoglobulins (IgG, IgA, IgM) peroxidase conjugate (A0412, Sigma; 1:2000 dilution) or goat anti-rabbit IgG (whole molecule) peroxidase conjugate (A6154, Sigma; 1:2000 dilution), respectively. Bioluminescence was catalyzed using a Quick Spray Chemiluminescent HRP Antibody Detection Reagent (Thomas Scientific, E2400), and bands were detected in a luminescent image analyser PXi (Syngene).