Hiseq 2000 flow cell

T cell clones with the biggest difference between low and high PDs were selected for small RNA-sequencing. Samples were barcoded and sequenced with Illumina HiSEQ 2000 flowcell (Illumina). The sequence reads were analyzed using the CLC BIO Genomic Work Bench Suite 4.5 (CLC BIO, Arhus, Denmark). Reads were mapped to the mature miRNAs using miRDeep2 (27 (link)). The number of mapped reads of each sample was normalized to 1 × 10⁶. Normalized data were imported to GeneSpring (v.11.5.1) for analysis. A total of 252 miRNAs were present in at least 3 out of 12 samples with a read count >10. Mann–Whitney U test was performed to identify significantly differentially expressed miRNAs. Genesis (Release 1.7.6) was used to generate heatmaps. Raw and processed data are available via the Gene Expresison Omninbus, accession #GSE106619.

Template DNA was fragmented using a bioruptor (Diagenode, Liège, Belgium), and products of 200–500 bp were recovered using the MinElute PCR Purification kit (Qiagen, Valencia, CA). This was followed by end repair, phosphorylation, dA-tailing and adaptor ligation using the respective NEBNext-modules (New England Biolabs, Ipswich, MA) to prepare samples for Illumina sequencing. Libraries were then tagged using short indexing amplification primers as previously described [24] (link) and sequenced as multiplexed single-read libraries for 100 cycles (including a 6 cycle index read) on a single lane of an Illumina HiSeq2000 flowcell, according to the manufacturer's protocol.

DNA samples described in previous 16S rRNA community profiling studies were used in the present study for shotgun sequencing. These comprised four termite samples; MC05, MC06, MC07, and IN01 (Abdul Rahman et al., 2015 (link)) and six anaerobic digester samples taken from 3 reactors (AD1-3) at two time points (day 96 and 362; Vanwonterghem et al., 2014 (link)). A publicly available sheep rumen metagenome (BioProject acc. PRJNA214227) was also included in the study together with two reference genomes; F. succinogenes S85 (BioProject acc. PRJNA41169) and C. alkaliphilus ACht1 (BioProject acc. PRJNA195589). Shotgun libraries were prepared using the Nextera XT Sample Preparation Kit (or TruSeq DNA Sample Preparation Kits v2 for AD1-3 day 96) (Illumina, San Diego, CA, USA) and library DNA concentrations were measured using the QuantIT kit (Molecular probes, Carsbad, CA, USA) and equimolar-pooled for sequencing. Between a quarter and a third of an Illumina HiSeq 2000 flowcell of paired-end sequences (2 × 100 bp with an average fragment size of 320) were obtained for each library.

Six small RNA libraries, representing 3 biological replicates from control‐ or BDNF‐treated cortical neurons, were prepared using NEBNext^® Multiplex Small RNA Library Prep Set for Illumina^® (Set 1) kit (New England BioLabs) as per manufacturer's instructions. Multiplexed small RNA libraries were sequenced for 50 cycles in a single lane of one Illumina HiSeq2000 flow cell (EMBL Heidelberg). Raw sequencing reads were trimmed from 3′ adapter (AGATCGGAAGAGCACACGTCT) and filtered according to quality using “percent = 90 and cutoff = 30” parameters of Fastx‐Toolkit for fastq data on Galaxy71 (https://usegalaxy.org/). Reads were excluded if they only contained the adapter sequence, did not contain the adapter sequence prior to trimming, or were shorter than 15 nucleotides. The remaining reads were mapped to the rat mature miRNAs (miRBase v21) using default parameters (one mismatch, 3 nt in the 3′ or 5′‐trimming variants, 3 nt in the 3′‐addition variants) of Miraligner software 72. For mature miRNA analysis, only those that are represented by at least 10 reads per million (RPM) in one of the conditions were considered. Differential expression analysis of miRNAs was performed using edgeR73, 74. Only isomiRs with at least 1 RPM in at least one of the experimental conditions were included for analysis.

Indexed samples were pooled, divided, and loaded onto eight lanes of an Illumina HiSeq2000 flow cell yielding 50-bp single-end reads. On average 60 million reads were collected for each sample. The resulting sequences were filtered and trimmed to remove low-quality bases (Phred score < 15) from the 3′ ends of the reads using a custom Perl script. The remaining sequences were mapped to the human genome (hg19) using GSNAP (version 2012-07-20)^{25 (link)}. After alignment, Cufflinks (version 2.2.1)^{26 (link)} was used to assemble transcripts and estimate the gene expression values expressed as fragments per kilobase per million (FPKM). In the programming language R, the FPKM values from all 14 samples were used for the principal components analysis.

To validate our in vitro sequencing in tissue, cardiomyocytes and non-cardiomyocytes were isolated from 8-week-old male wild-type C57BL/6 mice as described previously by Trembinski et al. [29 (link)]. Briefly, cardiomyocytes were separated from other cells, such as fibroblasts and ECs, via density centrifugation. RNA isolation was done using the RNeasy Mini Kit and the RNase-Free DNase Set (Qiagen). RNA sequencing was performed as described previously [30 (link)]. Briefly, poly-A RNA was selected using poly-T oligo attached beads. Sequencing libraries were prepared using the TruSeq RNA sample preparation kit (Illumina) and sequencing was done using the HiSeq 2000 flowcell (Illumina). Reads were mapped using TopHat (2 mismatches) and gene expression was estimated using Cufflinks version 2.1 with default parameters.