Terminal deoxynucleotidyl transferase
Terminal deoxynucleotidyl transferase is an enzyme that catalyzes the addition of deoxynucleotides to the 3' hydroxyl terminus of DNA strands. It is used in molecular biology and genetics research.
Lab products found in correlation
18 protocols using terminal deoxynucleotidyl transferase
TUNEL Assay for Apoptosis in Testes
Rapid Amplification of BAFF-like Transcript
Isolation and Sequencing of F. proliferatum Transaldolase
The full-length cDNA of the F. proliferatum transaldolase was obtained by 5' rapid amplification of cDNA end (RACE) reaction. The template cDNA for the reaction was synthesized with reverse transcriptase (RT, Stratagene) and primer GSP-r1 (5'-529aagagagaacatgagggtgaggtt506-3'). An oligo-(dC) was added to the end of the purified cDNA with terminal deoxynucleotidyl transferase (Promega). Primers GSP-r2 (5'-336tcgacctcagttgagacctt317-3') and 5R AAP (5'-ggccacgcgtcgactagtacgggiigggiigggiig-3') were then used in the 5'-RACE reaction. The product was purified, subcloned, transformed and subsequently sequenced.
Detecting DNA Strand Breaks in Retinal Cells
In situ hybridization of NMDA receptor subunits in rat brain
Transcriptome Analysis of P. aeruginosa
Identification of dcw Operon Transcription Start Site in B. cenocepacia J2315
TUNEL Assay for DNA Strand Breaks
TUNEL Assay for Photoreceptor DNA Damage
RACE Analysis of Bremia Viral ORFan 2
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!