To examine the Sirt3 level, cochlear explants were lysed in RIPA buffer (Millipore, Temecula, CA, USA) supplemented with Complete Protease Inhibitor Cocktail, 2 mM PMSF, and 0.1% SDS. The protein concentration was measured using the BCA assay kit (Thermo Scientific, Rockford, IL, USA). Total protein (~30 μg) was separated by 10% SDS-PAGE and then transferred to 0.45 μm Nitrocellulose Membrane (Millipore). The membrane was blocked with TBST containing 5% non-fat milk, incubated with anti-SIRT3 antibody (1:100; Cell Signal Technology) at 4 °C overnight and then hybridized with appropriate HRP-conjugated secondary antibody at room temperature for 1 h. Protein signals were visualized using ECL detection system (Thermo Scientific). For qRT-PCR analysis (ABI Prism 7900HT) of Sirt3, total RNA was isolated by the RNeasy Mini Kit (Qiagen). And cDNA was synthesized from total RNA with PrimeScript 1st Strand cDNA Synthesis Kit (Takara). The primers used are 5′- gcggctctacacacagaacat- 3′ (forward) and 5′- caggtttcacaacgccagta - 3′ as (reverse). β-tubulin was used as a control.
Abi prism 7900ht
Manufactured by Qiagen
The ABI Prism 7900HT is a high-throughput real-time PCR system designed for accurate and reliable gene expression analysis. It features 384-well plate format, a thermal cycler, and a sensitive optical detection system. The instrument is capable of performing quantitative, multiplexed, and comparative gene expression studies.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (2 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Nitrocellulose membrane, by Merck Group (1 mentions)
Ecl detection system, by Thermo Fisher Scientific (1 mentions)
Primescript 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Anti sirt3 antibody, by Cell Signaling Technology (1 mentions)
Ripa buffer, by Merck Group (1 mentions)
Bca assay kit, by Thermo Fisher Scientific (1 mentions)
Rna midi kit, by Qiagen (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Rt2 sybr green rox fast mastermix, by Qiagen (1 mentions)
Superscript 3 first strand synthesis supermix for qrt pcr, by Thermo Fisher Scientific (1 mentions)
Mm01545399 m1, by Thermo Fisher Scientific (1 mentions)
Quantstudio 12k flex real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rt2 qpcr primer assay, by Qiagen (1 mentions)
Rt2 first strand kit, by Qiagen (1 mentions)
4 protocols using abi prism 7900ht
1
Sirt3 Quantification in Cochlear Explants
2
Cardiac mRNA Isolation and Quantification
3
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol (Thermo Fisher) according to the manufacturer’s protocol. RNA concentration was determined using a NanoDrop (Thermo Fisher) and equal amounts of RNA were added to cDNA synthesis reactions. cDNA was synthesized using the SuperScript III First-Strand Synthesis SuperMix for qRT-PCR (Thermo Fisher) according to the manufacturer’s protocol. Real-time PCR was performed on an ABI Prism 7900HT sequence detection system using RT2 SYBR Green/ROX FAST master mix (Qiagen) using the primers listed in Table S4 . Relative quantification was calculated as 2(−ΔΔCT) using β-actin as a reference gene. For analysis of Gdf11 expression from the MACS-purified CD19+ and CD19- splenic cells, real-time PCR analysis was performed with Taqman probes for Gdf11 (Mm01159973_m1, Taqman Gene Expression Assays, Thermo Fisher) and Hprt (Mm01545399_m1, Taqman Gene Expression Assays, Thermo Fisher). Relative quantification was calculated as 2(−ΔΔCT) using Hprt as a reference gene.
4
Profiling Inflammatory Gene Expression in Murine Colitis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from mouse proximal colons using the RNeasy mini kit (Qiagen, Valencia, CA) as described by the manufacturer. For PCR array analysis, 1,000 ng of total RNA was reverse transcribed into cDNA using the RT2 first-strand kit according to the manufacturer's instructions (Qiagen). PCR was performed using a QuantStudio 12K Flex real-time PCR system (Thermo Fisher Scientific, Waltham, MA). We used a commercial PCR array set, namely, Mouse Inflammatory Response & Autoimmunity 384HT from Qiagen. Amplification and preparation were performed in accordance with the manufacturer's guidelines. Target genes (Table S3 ) in the samples were further confirmed by RT2 qPCR Primer Assays from Qiagen using an ABI Prism® 7900HT sequence detection system. The expression level of each gene was normalized to the housekeeping gene levels, and fold changes were calculated by comparing the DSS-treated and untreated control groups. The samples were analyzed using the RT2 Profiler PCR array data analysis software version 3.5. A heatmap was drawn using shinyheatmap 54 (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!