Total RNA from cultured cells and mouse carotid arteries were extracted as previously described [17 ]. CDNA was amplified with inventoried gene assay products containing two human gene-specific primers (ACTA2 (SMA), Hs00909449_m1; CNN1 (calponin), Hs00923894_m1; Applied Biosystems, Grand Island, NY), four mouse gene-specific primers (ACTA2, Mm725412_s1; Cnn1, Mm00487032_m1; Sm22 (Tagln), Mm00441661_g1; and Smtn, Mm00449973_m1; Applied Biosystems), and one FAM dye labeled Taq Man MGB probe using 7500 Real Time PCR System (Applied Biosystems). Relative gene expression was calculated by 2−ΔΔCt method after normalization to eukaryotic 18S.
Acta2
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Acta2 is a laboratory instrument designed for spectrophotometric analysis. It is capable of measuring the absorbance of samples across a range of wavelengths, enabling researchers to quantify the concentration of specific analytes in their samples.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 1000, by Thermo Fisher Scientific (4 mentions)
Gapdh, by Thermo Fisher Scientific (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Rneasy fibrous tissue mini kit, by Qiagen (2 mentions)
Il 10, by Thermo Fisher Scientific (2 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Maxima reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
β actin, by Thermo Fisher Scientific (2 mentions)
Abi viia7 real time pcr detection system, by Thermo Fisher Scientific (2 mentions)
Taqman one step rt pcr master mix reagent, by Thermo Fisher Scientific (2 mentions)
Lysing matrix d, by MP Biomedicals (2 mentions)
Direct zol rna microprep, by Zymo Research (2 mentions)
Tri regeant, by Zymo Research (2 mentions)
Quantitect probe rt pcr kit, by Qiagen (2 mentions)
Qiazol reagent, by Qiagen (2 mentions)
Tgfb1, by Thermo Fisher Scientific (2 mentions)
Col1a2, by Thermo Fisher Scientific (2 mentions)
Pdgfrb, by Thermo Fisher Scientific (2 mentions)
18 protocols using acta2
1
Quantitative PCR Analysis of Vascular Genes
2
Renal Fibrosis RNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from stenotic kidney tissues using RNeasy plus Mini kit (Qiagen, Valencia, CA) (N = 17 WT RAS, N = 6 WT Sham, N = 20 Ccl2 KO RAS, N = 8 KO Sham). RNA quantification was done using spectrophotometry (NanoDrop Technologies, Wilmington, DE). RNA quality was assessed using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). First-strand cDNA was prepared from total RNA using iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). Real time PCR amplification reactions were performed on a Bio-Rad IQ5 real-time PCR detection system. The sequences for primers used in the studies were described earlier20 (link) except Gata3 (Forward:5′-AAG CTC AGT ATC CGC TGA CG-3′ Reverse: 5′-GAC ACC TCT GCA CCG TAG CC-3′) and Rorc (Forward: 5′-CCC TAG GCT TGC CTT GTA GG-3′ Reverse:5′-CCC ATC TAC CCC ACA GCT TC-3′). Commercially available primers for Gapdh, Acta2 and Col3A were used (ThermoFisher Scientific, Waltham, MA).
3
Gene Expression Analysis of Heart Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the heart tissues using RNeasy Fibrous Tissue Mini kit (Qiagen, Valencia, CA). RNA quantification was done using spectrophotometry (NanoDrop Technologies, Wilmington, DE). RNA quality was assessed using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). First-strand cDNA was prepared from total RNA using iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). Real time PCR amplification reactions were performed on a Bio-Rad CFX96 real-time PCR detection system. Commercially available primers were used for ACTA2 and GAPDH (ThermoFisher Scientific, Waltham, MA). The sequences for other primers used are provided in S1 Table .
4
Immunoblotting for Cell Signaling Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell monolayers were washed with ice-cold PBS and lysed in triple-detergent lysis buffer [50 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.02% sodium azide, 0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate, 100 μg/ml PMSF, 2 μg/ml pepstatin, 2 μg/ml aprotinin, 2 μg/ml leupeptin, and phosphatase inhibitors cocktail 2 or 3 (cat.#P5726, P0044, Sigma-Aldrich)]. SDS-PAGE and immunoblotting were performed under standard conditions. Basically, samples in Laemmli buffer (30 μg/lane) were separated through 8% or 12% gels and transferred to nitrocellulose membranes for 90 min at RT in the presence of 20% methanol and 0,1% SDS. Membranes were blocked with 3% BSA in PBS-Tween 0,05% (PBST-BSA) and incubated O/N at 4 °C with specific antibodies diluted in PBST-BSA. Antibodies used were: γH2AFX (cat.#05–636, Millipore), CDKN1A (cat.#sc-6246, Santa Cruz Biotech), CDKN2A (cat.#04–239, Millipore), CDKN2A (Millipore, cat.#PA5–20379), ACTA2 (cat.#MA5–11547, Thermoscientific), VIMENTIN (cat.#MA1–10459, Thermoscientific), Vitamin D receptor (VDR) (cat.#12550S, Cell Signaling), Tata box-binding protein (TBP) (cat.#818, abcam), tubulin (TUBA1A) (cat.#T9026, Sigma-Aldrich) and actin β (ACTB) (cat.#8224, abcam).
5
Immunofluorescence Staining of Tissue Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expanded cells were fixed with 4% paraformaldehyde in 0.1 M PBS for 30 min at 4°C and washed three times. Fixed cells were reacted with blocking solution (PBS with 20% BlockAce [KAC, Kyoto, Japan], 5% BSA [Nacalai Tesque], and 0.3% Triton X-100 [Wako]] for 30 min at room temperature. The following primary antibodies were used: ectodermal marker, neurofilament M (NEFM; 1:200; Millipore, Burlington, MA, USA); endodermal marker, cytokeratin 7 (KRT7; 1:100; Agilent, Santa Clara, CA, USA); and mesodermal cell marker, smooth muscle actin (ACTA2; 1:500: ThermoFisher Scientific). Primary antibodies were diluted in primary antibody dilution buffer (PBS with 5% BlockAce [KAC], 1% BSA [Nacalai Tesque], and 0.3% Triton X-100 [Wako]) and incubated with cells for overnight at 4°C. After three washes, the cells were incubated with Alexa 568-conjugated donkey anti-mouse IgG antibody (1:500: ThermoFisher Scientific), Alexa 647-conjugated donkey anti-rabbit IgG antibody (1:500: Jackson Immuno Research) diluted in secondary antibody dilution buffer (PBS with 0.2% Triton X-100 [Wako]) for 1 h at room temperature. Cells were also stained with 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes, Eugene, OR, USA). Samples were imaged under a fluorescent microscope (BZ-X710; Keyence, Osaka, Japan) at 400x magnification.
6
Quantitative Analysis of Cardiac Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purified monocytes and single cell isolated heart tissue resuspended in RLT lysis buffer were used to extract RNA using RNeasy Mini Kit (Qiagen, 74106). The concentration of RNA was measured using NanoDropTM 2000 (Thermo Fisher Scientific). Isolated RNA was made into cDNA using High Capacity RNA-to-cDNA Kit (Applied Biosystems, 4387406). Gene expression was measured through qRT-PCR using TaqMan® gene expression master mix (Thermo Fisher Scientific, 4369016) protocol on the BioRad iCycler iQ5 (1708740).
Taqman primers for quantitative real-time polymerase chain reaction (qRT-PCR) of Fcgr1 (Mm00438874_m1), Cxcl1 (Mm04207460_m1), Il10 (Mm01288386_m1), Il27 (Mm00461162_m1), Arg1 (Mm00475988_m1), Cxcl12 (Mm00445553_m1), Chil3 (Mm00657889_mH), Nos2 (Mm00657889_mH), Acta2 (Mm00725412_s1), Postn (Mm01284919_m1), Fn1 (Mm01256744_m1), Col1a2 (Mm00483888_m1) were purchased from Thermo Fisher Scientific.
Taqman primers for quantitative real-time polymerase chain reaction (qRT-PCR) of Fcgr1 (Mm00438874_m1), Cxcl1 (Mm04207460_m1), Il10 (Mm01288386_m1), Il27 (Mm00461162_m1), Arg1 (Mm00475988_m1), Cxcl12 (Mm00445553_m1), Chil3 (Mm00657889_mH), Nos2 (Mm00657889_mH), Acta2 (Mm00725412_s1), Postn (Mm01284919_m1), Fn1 (Mm01256744_m1), Col1a2 (Mm00483888_m1) were purchased from Thermo Fisher Scientific.
7
RNA Extraction and qRT-PCR Analysis of Proangiogenic Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the MSC and MSC_LIF cell lines using the TRIZOL® extraction reagent (Thermo Fisher Scientific). The quantification of RNA was performed on a NanoDropTM 1000 spectrophotometer (Thermo Fisher Scientific). The purity of the samples obtained by the ratio A260 nm: A280 nm demonstrated a proportion between 1.8 and 2.0. Aliquots of 1 μg of high quality RNA were used for cDNA synthesis using SuperScript III reverse transcriptase (Invitrogen Waltham, MA, United States) after treatment with DNAse I. To analyze the expression of proangiogenic factors in MSC and MSC_LIF cells, we used the following primer sets purchased from Integrated DNA TechnologiesTM (Coralville, IA, United States): ACTA2, TAGLN, COL4A1, CCL2, CXCL2, ANG, VEGF, and NG2 (Table 1 ), and Sybr Green (Thermo Fisher Scientific). The reactions were done in triplicate, and the average cycle thresholds (Ct) values were used to calculate the expression of each gene using the B2M gene as a normalizer. The PCR amplification was performed on an ABI7500 real-time PCR system (Thermo Fisher Scientific), under standard thermal cycle conditions.
8
Cardiac Gene Expression in Mice
9
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Freshly dissected tissue from the rim of healing appendages were manually dissociated with scissors, collected in TRI Regeant (Zymo) and then mechanically disrupted (Fastprep 24, Lysing Matrix D, MP Bio). Total RNA was isolated by Direct-Zol RNA MicroPrep (Zymo). RNA concentration was measured by Nanodrop 1000 (Thermo Scientific). cDNA synthesis was performed with Maxima Reverse Transcriptase (Thermo Scientific) per manufacturer’s instructions. One-step quantitative RT–PCR was performed and analyzed using an ABI ViiA7 Real-Time PCR detection system (Applied Biosystems) with TaqMan one-step RT–PCR Master Mix Reagents. Taqman probes were purchased for mouse (Acta2, beta-actin, Cxcl12, Cdkn1a, Ezh2) and human genes (beta-actin, Cxcl12, Ezh2) (Applied Biosystems).
10
Quantifying Gene Expression in Organoids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA and RNA were extracted and purified from in vitro cultures on day 7 using the commercially available DNeasy and RNeasy kits (Qiagen, Valencia, CA), respectively. The qPCR reactions were prepared using the Quantitect Probe RT-PCR Kit (Qiagen). The primers and probe for eGFP-DNA were custom-designed and purchased from Eurofins MWG Operon, (Huntsville, AL) with 5′-ACTACAACAGCCACAACGTCTATATCA-3′ , 5′-GGCGGATCTTGAAGTTCACC-3′ , and 5′-(6-FAM)CCGACAAGCAGAAGAACGGCATCA(Tamra-Q)-3′ forward, reverse, and probe sequences, respectively. mRNA expression levels were assessed with reverse transcriptase qPCR, using commercially available primers and probes for target genes Acta2, Vim, Des, Lgr5, Cdx2, Lyz1, Chga, Muc2, and Vil1 (Applied Biosystems, Carlsbad, CA). The qPCR reactions were performed on an Applied Biosystems Prism 7900 Sequence Detection System. DNA qPCR results were normalized to the monocultures without ISEMF; RNA reverse transcriptase qPCR cycle numbers were analyzed according to the comparative CT method using GAPDH as the housekeeping gene and whole small bowel as the tissue of reference [24] (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!