Wortmannin

The human NK/T-cell lymphoma cell lines SNK-6 (ATCC) were cultured in RPMI-1640 (BioChannel Biological Technology Co., Ltd.) supplemented with 10% fetal bovine serum (FBS; BioChannel Biological Technology Co., Ltd.) and 700 U/ml interleukin-2 (IL-2), and incubated at 37°C and 5% CO₂. Losartan (an antagonist of AT1R [18 (link)]; 10⁻⁵ M), wortmannin (an inhibitor of PI3K [19 (link)]; 10⁻⁷ nM, Selleck, Shanghai, China) or MK2206 (an inhibitor of Akt [20 (link)]; 5 × 10⁻⁶ μM, Selleck) pretreatment lasted for 30 min, then, Ang II (10⁻⁶ M) was added.

Short-term (72 h drug exposure) was performed as previously described^{21 (link)}.
For long-term exposure, cells were seeded at low density in a six-well plate. Treatment started 24 h later, and refreshed twice weekly until 80% confluency. Cells were stained using crystal violet (Sigma-Aldrich) after fixation using 2% paraformaldehyde (Sigma-Aldrich, Zwijndrecht, The Netherlands).
KU-60019, Wortmannin, ETP-46464, VE-821, MK-8776 (SCH 900776), PF-477736, LY2603618/Rabusertib, and Palbociclib were purchased from Selleckchem (Munich, Germany), LY2606368/Prexasertib from Medchem (Sollentuna, Sweden). Adavosertib (MK-1775) from Biovision (Milpitas, USA). All were dissolved in a DMSO stock dilution (10 mM), except Palbociclib (10 mM in ddH₂O). Assays contained <1% DMSO. All drug-survival assays depict the standard error of the mean (SEM) of three independent experiments in triplicate.

The antibodies used are listed in Table S2. The plasmid pPH-Akt-GFP encoding PH-Akt-GFP was a gift from Tamas Balla (Addgene plasmid no. 51465). The plasmids encoding wild-type Rac1 tagged with GFP (Rac1-wt-GFP) and a mutant protein bearing a change of T to N at position 17 (Rac1-T17N) and tagged with GFP (Rac1-DN-GFP) were kindly provided by Stefan Linder (University Hospital Hamburg-Eppendorf, Germany).
Recombinant LecB was produced in Escherichia coli BL21(DE3) cells and purified with affinity columns as previously described (19 (link)). LecB and fluorophore-conjugated LecB were used at a concentration of 50 μg/mL (4.3 μM) unless stated otherwise. The B-subunit of Shiga toxin 1 (StxB) recombinantly produced in Escherichia coli was from Sigma-Aldrich. LY294002, wortmannin, PP2, SU6656, PIK-75, TGX-221, and triciribine were from Selleckchem. UEA-I was from Vector Labs. Human epidermal growth factor (EGF), l-fucose (6-deoxy-l-galactose), and fluorescein isothiocyanate (FITC)-dextran (70 kDa) were from Sigma-Aldrich. Phalloidin-Atto 488 and phalloidin-Atto 647 were from Atto-Tec.

Recombinant VEGF165 proteins (Sino Biological Inc, Beijing, China) of different concentrations (10, 40, 100, and 300 ng/mL) were included in the medium for 10 minutes during the dose‐response experiments. In some experiments isolated ventricular cardiomyocytes were pretreated with a PI3K inhibitor (100 nmol/L wortmannin, Selleck Chemicals, Houston, TX) for 1 hour before the addition of VEGF165 (100 ng/mL), and the inhibitor was present throughout the experiments in order to determine whether PI3K‐mediated signaling is involved in VEGF165‐induced inhibition of I_Ks and prolongation of APD.

Primary antibodies against p53, Phospho-Akt(S473), total-AKT, PUMA, cleaved PARP, Ki67, and cleaved Caspase3 were purchased from cell signaling; alpha-tubulin antibody was from Santa Cruz Technologies. Lipofectamine™ Reagent was purchased from Invitrogen. HRP-conjugated anti-rabbit or anti-mouse secondary antibodies and an ECL-plus kit were from GE Healthcare. 5-FU was purchased from APP Pharmaceuticals and NVP-BEZ235 was purchased from LC Laboratories. The plasmid of expressing PUMA was kindly supplied by Jian Yu, Ph.D. [9 (link)]. The oligonucleotide for shFOXO3a was synthesized as 5′-CACCGACTCCGGGTCCAGCTCCACTTCAAGAGAGTGGAGCTGGACCCGGAGTTTT TTTG-3′. NVP-BBD130 was purchased from Axon Medchem. Wortmannin and Rapamycin (Sirolimus) were purchased from Selleck Chemicals. Other chemicals were mainly from Sigma.

Tripchlorolide was purchased from Amresco (Amresco, CA, USA). The cell-counting Kit-8 (CCK-8) assay was purchased from Dojin- do (Dojin- do, Japan), and dimethyl sulfoxide (DMSO) was purchased from Sigma (St. Louis, MO, USA). Wortmannin (a PI3K inhibitor), perifosine (an AKT inhibitor) and rapamycin (a mTOR inhibitor) were obtained from Selleck (Selleck Chemicals, CA, USA). Antibodies against PI3K, PI3P, AKT, TSC2, P70S6K, and 4E-BP1 and their corresponding secondary antibodies were obtained from Santa Cruz (Santa Cruz, CA, USA). An enhanced chemiluminescence (ECL) kit was purchased from PerkinElmer (Waltham, MA, USA). The AKT activity was measured using a KinaseSTARTM AKT activity assay kit (BioVision). A PI3K enzyme-linked immunosorbent assay kit was obtained from Echelon Bioscience.