Mirna mimic control

FLS were cultured in 12‐well or 6‐well plates 24 hrs earlier to transfection. miRNA control mimic (5′ UUG UAC UAC ACA AAA GUA CUG 3′), miR‐10a‐5p mimic (5′ UAC CCU GUA GAU CCG AAU UUG UG 3′), miRNA control inhibitor (5′ CAG UAC UUU UGU AGU ACA A 3′) and miR‐10a‐5p inhibitor (5′ CAC AAA UUC GGA UCU ACA GGG UA 3′) (GenePharma, China) were transfected at a final concentration of 50 nM with Lipofectamine 2000 (Invitrogen, USA). After 24 and 48 hrs of transfection, RNA and protein were extracted respectively.

TBX5 3′UTR segment was cloned by PCR (Forward primer: GCG GAG CTC GAA ATG AAA CCC AGC ATA; reverse primer: GCG AAG CTT AGC CTC ACA TCT TAC CCT), and then inserted into downstream of the luciferase gene between SacI and HindIII sites within the pMIR‐Report™ luciferase vector (Ambion, Austin, USA). The pRL‐TK vector (Promega, Fitchburg, USA) was used as a control. All plasmid vectors were extracted with the EZNA™ Endo‐free Plasmid Maxi Kit (Omega BioTek, Norcross, USA). The constructed vectors were then sent to the company (GenScript Company, Nanjing, China) for the verification of sequence integrity.
HeLa cells were cultured in a 48‐well plate containing DMEM high‐glucose medium (HyClone, USA) supplemented with 10% FBS (HyClone) 24 hrs before transfection. Then cells (0.5 × 10⁵ cells per well) were transfected with firefly pMIR‐Report™ luciferase (Ambion) and Renilla pRL‐TK (Promega) vectors (90 ng:10 ng per well) and at the same time with 50 nM miRNA control mimic or 50 nM miR‐10a‐5p mimic (GenePharma, China). The Renilla luciferase reporter was used for normalization. After 24 hrs of transfection, the cells were lysed, and luciferase activity was detected using Dual‐Luciferase^® Reporter 1000 Assay System (Promega) by a plate‐reading luminometer (Tecan).

SK-BR-3 or SNU-216 cancer cells were seeded into 6-well plates (6×10⁵ cells/well), 100 nmol/L miR-3622b-5p mimic or 100 nmol/L miRNA mimic control was transfected by Lipofectamine 2000 (Invitrogen, Long Island, NY, USA) according to the manufacturer's protocol, respectively. The miR-3622b-5p mimic and miRNA mimic control were chemically synthesized by Shanghai GenePharma Company (Shanghai, China). Twenty four hours after transfection, cells were seeded into 96-well plates (5×10³ cells/well). Another forty eight hours after drug administration, cell viability was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay. The absorbance at 490 nm in each well was read on a spectrophotometer. The concentration at which drugs produced 50% inhibition of growth (IC50) was estimated by the relative survival curve. Three independent experiments were performed in quadruplicate.

On day 1, HEK293 cells were plated in a 6-well plate at a density of 0.5 × 10⁶ cells per well. The following day, the cells were transfected with 250 ng of pmirGLO Dual-Luciferase miRNA Target Expression Vector (E1330 from Promega) containing Wnt5a 3′-UTR sequence, together with miR-15b-3p mimics or miRNA mimic control (Genepharma) at a final concentration of 50 nM. LNA inhibitors (Exiqon) were used at a concentration of 20 nM. Experiments were performed in triplicate. Luciferase activity was measured 72 h post-transfection using the Dual-Luciferase Reporter Assay System (E1960 from Promega) according to the manufacturer’s protocol. Renilla luciferase activity was normalized with respect to firefly luciferase activity and the percentage inhibition was calculated.

For HOTAIR knockdown, HeLa cells were transfected with 50 nM of siRNAs targetting HOTAIR (GAACGGGAGUACAGAGAGAUU) and siGFP (CUACAACAGCCACAACGUCdTdT) were used as scrambled control [25 (link)]. Full length of HOTAIR, miR-23b mimic, miRNA mimic control, 2′-O-methyl (2′-O-Me)-modified miR-23b inhibitor, and miRNA inhibitor control were chemically synthesized by Shanghai GenePharma Company (Shanghai, China).