Tsks KO mice were produced with the CRISPR/Cas9 genome editing system. To avoid the off-target editing, CRISPRdirect software (https://crispr.dbcls.jp/ ) was used (41 (link)). ES cells were used to produce the mice, as previously described (28 (link)). We designed guide RNAs and inserted the sequence into the pX459 V2.0 plasmid (#62988, Addgene). The EGR-G01 ES cells were co-transfected with two guide RNA–inserted vectors using Lipofectamine LTX with Plus Reagent (ThermoFisher Scientific). Cells were selected using puromycin and genotyping. Mutant ES clones with normal karyotypes were aggregated into 8-cell or morula stage ICR embryos, and they were cultured to the blastocyst stage. A pseudopregnant female ICR recipient was used to implant them into the uterus 2.5 d after mating with a vasectomized male. The resulting chimeric male spermatozoa were used for intracytoplasmic sperm injection (ICSI) to obtain KO mice. Genotyping was conducted by Sanger sequencing and PCR. The primers and PCR conditions for genotyping are listed in SI Appendix, Table S1 .
Px459 v2.0 plasmid
Manufactured by Addgene
Sourced in United States
The PX459 V2.0 plasmid is a vector for CRISPR/Cas9-mediated gene editing. It contains a human U6 promoter-driven expression cassette for a single guide RNA (sgRNA) and a CMV promoter-driven Cas9 expression cassette. The plasmid also includes a puromycin resistance gene for selection of transfected cells.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine ltx, by Thermo Fisher Scientific (1 mentions)
Plus reagent, by Thermo Fisher Scientific (1 mentions)
Opti mem medium, by Thermo Fisher Scientific (1 mentions)
Penicillin and streptomycin, by Thermo Fisher Scientific (1 mentions)
Sodium pyruvate, by Merck Group (1 mentions)
Rpmi 1640, by Merck Group (1 mentions)
Fetal bovine serum (fbs), by Merck Group (1 mentions)
2 mercaptoethanol, by Thermo Fisher Scientific (1 mentions)
Facsaria iiu, by BD (1 mentions)
Puromycin, by Merck Group (1 mentions)
4d x unit, by Lonza (1 mentions)
Nucleofector solution, by Lonza (1 mentions)
6 protocols using px459 v2.0 plasmid
1
Generating CRISPR-Edited Knockout Mice
2
Stable Cas9 Expression in HP45 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ALV-transformed HP45 cells [36 (link)] were cultured in RPMI 1640 (Sigma-Aldrich, Burlington, MA, USA) supplemented with 10% tryptose phosphate broth (TPB), 10% heat inactivated FBS (Sigma-Aldrich, Burlington, MA, USA), 10 mM Sodium pyruvate (Sigma-Aldrich, Burlington, MA, USA), 50 mM 2-mercaptoethanol (GIBCO, Waltham, MA, USA) and 100 units/mL penicillin and streptomycin (GIBCO, Waltham, MA, USA), kept at 38.5 °C incubator with 5% CO2 and humidity.
To generate the stable HP45 cell line expressing Cas9, 1 × 106 of HP45 cells were resuspended in 96 µL of Opti-MEM medium (GIBCO, Waltham, MA, USA) and electroporated with 10 µg of pX459-V2.0 plasmid (Addgene, Watertown, MA, USA) using a NEPA21 electroporator (Sonidel Ltd., Dublin, Ireland). After selection with 1 µg/mL puromycin (Sigma-Aldrich, Burlington, MA, USA) for 7 days, single cell clones were isolated using fluorescence-activated cell sorting using FACSAria IIu (BD Bioscience, Wokingham, Berkshire, UK). The single cell clone with Cas9 expression detected by Western blotting with anti-Flag antibody (Supplementary Figure S2 ) was grown and stored in liquid nitrogen for further studies.
To generate the stable HP45 cell line expressing Cas9, 1 × 106 of HP45 cells were resuspended in 96 µL of Opti-MEM medium (GIBCO, Waltham, MA, USA) and electroporated with 10 µg of pX459-V2.0 plasmid (Addgene, Watertown, MA, USA) using a NEPA21 electroporator (Sonidel Ltd., Dublin, Ireland). After selection with 1 µg/mL puromycin (Sigma-Aldrich, Burlington, MA, USA) for 7 days, single cell clones were isolated using fluorescence-activated cell sorting using FACSAria IIu (BD Bioscience, Wokingham, Berkshire, UK). The single cell clone with Cas9 expression detected by Western blotting with anti-Flag antibody (
3
Cas9-mediated Mouse Pgap4 Gene Targeting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct a Cas9 expression plasmid harboring gRNA targeting to mouse Pgap4 (Tmem246) gene, pX459 v2.0 plasmid (Addgene, #62988), which is a gift from Feng Zhang (66 (link)) was cut by BbsI, followed by ligation with annealed primer. The sequence of the primer was 5′- AGGCTTCGG CGACTCTCCTG-3′.
To construct a knock-in vector, homology arms were amplified by PCR using mouse genome as a template with following primer sets: mPgap4-KI-EcoRI-F1 and mPgap4-KI-MluI-R1 (5′-AAAAgaattcATTCGACCAGCAGGCTAAG-3′ and 5′-AAAAacgcgtAAGCCTCCGGAGAAGCAT-3′) and mP gap4-KI-NotI-F2 and mPgap4-KI-SpeI-R2 (5′-AAAAgcggccgc CACAGCTGTGCAGCTCTTC-3′ and 5′-AAAAactagtGTAC CGTAGGCTGGAGAAGAG-3′). Monomeric EGFP (mEGFP) sequence was obtained by clipping from pME-mEGFP plasmid with MluI and NotI. The knock-in vector was obtained by ligation with the two homology arms and mEGFP sequence into pBlueScript II (+) vector cut by EcoRI and SpeI.
To construct a knock-in vector, homology arms were amplified by PCR using mouse genome as a template with following primer sets: mPgap4-KI-EcoRI-F1 and mPgap4-KI-MluI-R1 (5′-AAAAgaattcATTCGACCAGCAGGCTAAG-3′ and 5′-AAAAacgcgtAAGCCTCCGGAGAAGCAT-3′) and mP gap4-KI-NotI-F2 and mPgap4-KI-SpeI-R2 (5′-AAAAgcggccgc CACAGCTGTGCAGCTCTTC-3′ and 5′-AAAAactagtGTAC CGTAGGCTGGAGAAGAG-3′). Monomeric EGFP (mEGFP) sequence was obtained by clipping from pME-mEGFP plasmid with MluI and NotI. The knock-in vector was obtained by ligation with the two homology arms and mEGFP sequence into pBlueScript II (+) vector cut by EcoRI and SpeI.
4
Generation of JIP3 Knockout HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PX459 V2.0 plasmid was obtained from Addgene (62988). The following gRNA primer 5′ – CACCGAGAAGTGATCATGGAGACCA-3′ was cloned into PX459 using BbsI overhangs. HeLa cells were transfected with the plasmid followed by puromycin selection (1.5 μg/ml) 48 h post transfection. Cells were then seeded into 96-well plates to ideally obtain one cell per well, which were then subsequently expanded and screened for KO clones. For generation of JIP3 KO line, three synthetic gRNAs (Synthego) were used: GACTTGGTGCCTGTGGTGCT, GGCTGCAGGCTCTCGTTGAG, and TGACCTGTACTTCCATGTTG. To prepare the RNP complexes, Cas9 2NLS nuclease (Streptococcus pyogenes) (Synthego) and the reconstituted sgRNA were added to the Nucleofector solution (Lonza). Mixture was incubated at RT for 15 min and added to freshly harvested HeLa cells and electroporated using 4D X Unit (Lonza). Positive KO clones were screened by PCR using primer flanking the cut sites.
5
Generation of Fbxl13 Large Deletion Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fbxl13 large deletion (LD) KO mice were generated as previously described [33 (link)]. We designed two gRNAs that recognize either exon 1 or exon 7 to avoid the cleavage of nearby genes (S2A Fig ) and inserted the sequences into the pX459 V2.0 plasmid (#62988, Addgene, Cambridge, MA, USA). EGR-G01 embryonic stem (ES) cells [34 (link)] were co-transfected with 1.0 μg of two gRNAs inserted vectors. Nine ES clones out of 48 had a large deletion of Fbxl13. ES cell clones that possessed the mutation were injected into ICR embryos and chimeric blastocysts were transferred into the uteri of pseudopregnant females. Generated chimeric male mice were mated with B6D2F1 female mice to obtain heterozygous KO mice. Fbxl13 KO mice were maintained by sibling matings.
6
CRISPR-Cas9 Knockout of Insig-1 and Insig-2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Insig-1 and Insig-2 were deleted from human fibroblast SV-589 cells using CRISPR-Cas9 technology. Briefly, oligonucleotide pairs encoding the indicated nucleotide guide sequences (OL1243/OL1244, OL1247/OL1248 for Insig-1 and OL1515/OL1516, OL1517/OL1518 for Insig-2, sequence listed in key resources table ) that target Insig-1 and Insig-2 were each annealed and cloned into the pX459 v2.0 plasmid (Addgene). All four plasmids were co-transfected into SV-589 cells using FuGENE 6. The transfected cells were subjected to selection with 1 μg/ml puromycin for two weeks. Single surviving colonies were picked, expanded, and screened by PCR followed by sequencing. Single-cell clones were isolated by limiting dilution to establish the Insig-1 and Insig-2 double knockout cell line (TR4410).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!