Log In Sign up
The largest database of trusted experimental protocols

Viia7 qpcr analyzer

Manufactured by Thermo Fisher Scientific
Visit Supplier

The Viia7 qPCR analyzer is a real-time PCR (polymerase chain reaction) instrument designed for nucleic acid quantification. It utilizes qPCR technology to amplify and quantify target DNA or RNA sequences. The Viia7 features 96-well block format and can accommodate a variety of sample volumes.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy mini kit, by Qiagen (7 mentions) Rnase inhibitor, by Thermo Fisher Scientific (4 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions) Sybr green reagent, by Thermo Fisher Scientific (1 mentions) Nanodrop lite spectrophotometer, by Thermo Fisher Scientific (1 mentions) High capacity cdna reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions) Rt2 first strand kit, by Qiagen (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions) Universal pcr master mix, by Thermo Fisher Scientific (1 mentions) Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

ViiA7 (579 citations) Viia7 qPCR (4 citations)

9 protocols using viia7 qpcr analyzer

1

Gene Expression Analysis by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells or whole tumor digests were lysed and RNA was purified using the RNEasy Mini Kit (Qiagen). cDNA was synthesized utilizing a high capacity reverse transcription kit with RNAse inhibitor (Applied Biosystems). A Taqman Universal PCR master mix was used to assess the relative expression of target genes compared to GAPDH on a Viia7 qPCR analyzer (Applied Biosystems). Primers were purchased from Thermo.
Greene S., Robbins Y., Mydlarz W., Huynh A., Schmitt N., Friedman J., Horn L.A., Palena C., Schlom J., Maeda D.Y., Zebala J.A., Clavijo P.E, & Allen C.T. (2019). Inhibition of MDSC trafficking with SX-682, a CXCR1/2 inhibitor, enhances NK cell immunotherapy in head and neck cancer models. Clinical cancer research : an official journal of the American Association for Cancer Research, 26(6), 1420-1431.
+ Open protocol
+ Expand
2

Quantitative Analysis of p15E Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was purified using the RNEasy Mini Kit (Qiagen). cDNA was synthesized utilizing a high capacity cDNA reverse transcription kit (Applied Biosystems). Relative expression of target genes compared to GAPDH was assessed on a Viia7 qPCR analyzer (Applied Biosystems). Custom primers to quantify p15E expression were synthesized by Integrated DNA Technologies: 5’-ATG GAA CCC GTC TCA CTA ACT CTG G and 3’-TCA CAG GGC CTG CAC TAC CGA AAT C.
Friedman J., Moore E.C., Zolkind P., Robbins Y., Clavijo P.E., Sun L., Greene S., Morisada M., Mydlarz W., Schmitt N., Hodge J., Schreiber H., Van Waes C., Uppaluri R, & Allen C.T. (2019). Neoadjuvant PD-1 immune checkpoint blockade reverses functional immunodominance among tumor-antigen specific T cells. Clinical cancer research : an official journal of the American Association for Cancer Research, 26(3), 679-689.
+ Open protocol
+ Expand
3

Quantitative HPV Typing in Clinical Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantitative RT-PCR was used to type HPV within clinical samples. Papilloma lysates were generated using the Tissue Lyser II and RNA was purified using the RNeasy Mini Kit (Qiagen, Valencia, CA) per the manufacturer’s protocol. cDNA was synthesized utilizing a high-capacity cDNA reverse transcription kit with an RNase inhibitor (Applied Biosystems). A TaqMan Universal PCR master mix was used to assess the relative expression (ΔΔCT2) of target genes compared with Gapdh on a Viia7 qPCR analyzer (Applied Biosystems) in technical triplicates. HPV L1 type-specific probes were custom designed for HPV 6 (F-5′- TGGGGTAATCAACTGTTTGTTACTGTGGTA-3′ and R-5′- GCATGTACTCTTTATAATCAGAATTGGTGTATGTG′3′) and HPV 11 (F-5′- CTGGGGAAACCACTTGTTTGTTACTGTG′3′ and R-5′-CGCATGTATTCCTTATAATCTGAATTAGTGTATGTA-3′).
Sievers C., Robbins Y., Bai K., Yang X., Clavijo P.E., Friedman J., Sinkoe A., Norberg S.M., Hinrichs C., Van Waes C, & Allen C.T. (2021). Comprehensive multiomic characterization of human papillomavirus-driven recurrent respiratory papillomatosis reveals distinct molecular subtypes. Communications Biology, 4, 1416.
+ Open protocol
+ Expand
4

RNA Isolation, cDNA Synthesis, and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated by solubilizing cells in 4 M guanidinium isothiocyanate; this was followed by phenol-chloroform extraction (Chomczynski and Sacchi, 1987 (link)). Quantification was done using a NanoDrop LITE spectrophotometer (Thermo Fisher Scientific, Waltham, MA). cDNA was synthesized using 1 μg of RNA and the High-Capacity cDNA Reverse Transcriptase Kit (Applied Biosystems). qPCR analysis was performed using SYBR-Green Reagents and a ViiA7 qPCR analyzer (Applied Biosystems) (see Supplemental Table 2 for primer sequences). Glyceraldehyde 3-phosphate dehydrogenase or porphobilinogen deaminase was used as a control gene in qPCR to normalize for variations in loading. Differences in target gene expression were determined using the ΔΔ-CT method (Livak and Schmittgen, 2001 (link)).
Wiles B., Miao M., Coyne E., Larose L., Cybulsky A.V, & Wing S.S. (2015). USP19 deubiquitinating enzyme inhibits muscle cell differentiation by suppressing unfolded-protein response signaling. Molecular Biology of the Cell, 26(5), 913-923.
+ Open protocol
+ Expand
5

Comprehensive Gene Expression Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Whole tumor lysates were generated using the Tissue Lyser II and RNA was purified using the RNEasy Mini Kit (Qiagen, Valencia, CA) per the manufacturer's protocol. cDNA was synthesized utilizing a RT2 First Strand Kit (Qiagen). A customized RT2 PCR array (Qiagen) was used to assess the relative expression of target genes compared to GAPDH on a Viia7 qPCR analyzer (Applied Biosystems, Carlsbad, CA).
Clavijo P.E., Moore E.C., Chen J., Davis R.J., Friedman J., Kim Y., Van Waes C., Chen Z, & Allen C.T. (2017). Resistance to CTLA-4 checkpoint inhibition reversed through selective elimination of granulocytic myeloid cells. Oncotarget, 8(34), 55804-55820.
+ Open protocol
+ Expand
6

Mouse Testis RNA Extraction and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from mouse testes using TRIzol reagent (Invitrogen). cDNA was synthesized from 1 μg of RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Primers used for RT-PCR and qPCR are shown in Table 1. QPCR was performed using Power SYBR® green PCR master mix in a ViiA7 qPCR analyzer (Applied Biosystems). Expression of genes was normalized to GAPDH. Differential expression was represented as fold change (2−ΔΔCT).
Bose R., Sheng K., Moawad A.R., Manku G., O’Flaherty C., Taketo T., Culty M., Fok K.L, & Wing S.S. (2017). Ubiquitin Ligase Huwe1 Modulates Spermatogenesis by Regulating Spermatogonial Differentiation and Entry into Meiosis. Scientific Reports, 7, 17759.
+ Open protocol
+ Expand
7

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were lysed or whole tumor lysates were generated using the Tissue Lyser II. RNA was purified using the RNEasy Mini Kit (Qiagen) per the manufacturer’s protocol. cDNA was synthesized utilizing a high-capacity cDNA reverse transcription kit with RNase inhibitor (Applied Biosystems). A TaqMan Universal PCR master mix was used to assess the relative expression of target genes compared with GAPDH on a Viia7 qPCR analyzer (Applied Biosystems). All primers were commercially available and purchased from Thermo Scientific.
Clavijo P.E., Friedman J., Robbins Y., Moore E.C., Smith E., Zauderer M., Evans E.E, & Allen C.T. (2018). Semaphorin4D Inhibition Improves Response to Immune-Checkpoint Blockade via Attenuation of MDSC Recruitment and Function. Cancer immunology research, 7(2), 282-291.
+ Open protocol
+ Expand
8

qPCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tumor lysates were generated using the Tissue Lyser II and total RNA was purified using the RNEasy Mini Kit (Qiagen, Valencia, CA) per the manufacturer's protocol. cDNA was synthesized utilizing a High Capacity cDNA Reverse Transcription Kit (Life Technologies, Waltham, MA). Taqman Single Tube primers and a Universal PCR Master Mix (Life Technologies) were used to assess the relative expression of target genes in comparison to GAPDH on a Viia7 qPCR analyzer (Applied Biosystems, Carlsbad, CA).
Cash H., Shah S., Moore E., Caruso A., Uppaluri R., Van Waes C, & Allen C. (2015). mTOR and MEK1/2 inhibition differentially modulate tumor growth and the immune microenvironment in syngeneic models of oral cavity cancer. Oncotarget, 6(34), 36400-36417.
+ Open protocol
+ Expand
9

Quantitative gene expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA from whole MC38, LLC, or MOC1 tumor lysates generated via Tissue Lyser II mechaniscal dissociation was purified using the RNEasy Mini Kit (Qiagen) per the manufacturer’s protocol. RNA purity and quantity was assessed on a Nanodrop Spectrophotometer based on basorbance at 260/280 and 260/230. cDNA was synthesized utilizing a high capacity cDNA reverse transcription kit with RNase inhibitor (Applied Biosystems) beginning with 2 μg or RNA template. A Taqman Universal PCR master mix was used to assess the relative expression (ΔΔCT2) of target genes compared to Gapdh on a Viia7 qPCR analyzer (Applied Biosystems) in technical triplicates. Custom primers were designed to flank nucleotide regions encoding the MHC class I-restricted epitopes for each tumor-associated antigen (Supplementary Table S1).
Nagaya T., Friedman J., Maruoka Y., Ogata F., Okuyama S., Clavijo P.E., Choyke P.L., Allen C, & Kobayashi H. (2019). Host immunity following near-infrared photoimmunotherapy is enhanced with PD-1 checkpoint blockade to eradicate established antigenic tumors. Cancer immunology research, 7(3), 401-413.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!