The total RNA was extracted from 35 pairs of lung cancer clinical specimens and adjacent normal specimens or lung cancer cells using TRIzol reagent (Invitrogen, CA, USA). 10 μg total RNA isolation was separated by 2 U/μg RNase R (Epicentre Technologies) for 30 min at 37°C. Random primers and stem-loop primers were used to synthesize cDNA using the TaKaRa system (Takara, Dalian, China). RT-PCR primers were purchased from RiboBio. circPTCH1-Forward: ACCAAAAGCCAAGGCAG -CGG, circPTCH1-Reverse: CCTCGCGTCGATATAAATCC; miR-34c-5p-Forward: CGGAGGCAGTGTAGTTAGCT, miR-34c-5p-Reverse: GTGCAGGGTCCGAGGT; U6-Forward:CTCGCTTCGGCAGCACA, U6-Reverse:AACGCTTCACGAATTTGC -GT; MYCN-Forward: ACCCGGACGAAGATGACTTCT, MYCN-Reverse: CAGCTCGTTCTCAAGCAGCAT; GAPDH-Forward: ACAACTTTGGTATCGTG GAAGG, GAPDH-Reverse: GCCATCACGCCACAGTTTC; Real-time PCR was detected by the CFX96 Tm Real-Time System (Bio-Rad, USA). The calculation method of relative expression was using the comparative Ct(2−ΔΔCt) method.
Rt pcr primers
Manufactured by RiboBio
Sourced in China
RT-PCR primers are short, synthetic DNA sequences designed to initiate the reverse transcription and subsequent amplification of specific RNA targets during real-time quantitative PCR (RT-qPCR) experiments. These primers are essential tools for the sensitive and accurate detection and quantification of gene expression levels in various biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Rnase r, by Illumina (2 mentions)
Cfx96 real time system, by Bio-Rad (2 mentions)
Sybr premix ex taq 2, by Takara Bio (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Lightcycler 480 system, by Roche (1 mentions)
Rna extraction kit, by Takara Bio (1 mentions)
Biosystems 7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Cdna reverse transcription kit, by Takara Bio (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Stem loop rt primer, by RiboBio (1 mentions)
Gapdh, by RiboBio (1 mentions)
Sybr primescript rt pcr kit, by Takara Bio (1 mentions)
6 protocols using rt pcr primers
1
Profiling of circPTCH1 and miR-34c-5p in Lung Cancer
2
Quantitative miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted using TRIzol reagent (Life Technologies, Carlsbad, CA, USA). The RT-PCR primers for miR125b and U6 snRNA were purchased from RiboBio (Guangzhou, China). Reverse transcription PCR was performed using the PrimeScript RT Reagent Kit (TaKaRa, Dalian, China) according to the manufacturer's instructions. The PCR primers were as follows: DKK3 forward, 5′- ACACAGACACGAAGGTTGGA-3′; DKK3 reverse, 5′- CGTCTCCCACAGATGTGATA-3′; 18s rRNA forward, 5′- CCTGGATACCGCAGCTAGGA-3′, 18s rRNA reverse, 5′-GCGGCGCAATACGAATGCCCC-3′; hsa-miR125b forward, 5′-ACACTCCAGCTGGGTCCCTGAGACCCTAACTTTCCCTGAG-3′, hsa-miR125b reverse, 5′- CTCAACTGGTGTCGTGGA-3′; U6 forward, 5′-CTCGCTTCGGCAGCACA-3′, and U6 reverse, 5′- AACGCTTCACGAATTTGCGT-3′.
PCR consisted of an initial denaturing step at 95°C for 1 min, followed by 40 cycles of 95°C for 30 sec, 60°C for 1 min, and 72°C for 1 min, and a final extension step at 72°C for 7 min. Real-time PCR was performed using SYBR Premix Ex Taq II (TaKaRa) and a Light Cycler 480 system (Roche, Basel, Switzerland). U6 level was used as an internal control. The 2−ΔΔCT method was used to determine fold changes in RNA levels in each sample compared to the reference sample.
PCR consisted of an initial denaturing step at 95°C for 1 min, followed by 40 cycles of 95°C for 30 sec, 60°C for 1 min, and 72°C for 1 min, and a final extension step at 72°C for 7 min. Real-time PCR was performed using SYBR Premix Ex Taq II (TaKaRa) and a Light Cycler 480 system (Roche, Basel, Switzerland). U6 level was used as an internal control. The 2−ΔΔCT method was used to determine fold changes in RNA levels in each sample compared to the reference sample.
3
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using an RNA extraction kit (TaKaRa, Japan) and 1000 ng RNA was used to reverse-transcribed into cDNA by the reverse transcription cDNA kit (TaKaRa, Japan). Quantitative real-time PCR was performed with 20 ng of cDNA using the SYBR® Premix ExTaq™ (TaKaRa, Japan). The mix was added to 96-well plate detected by a Biosystems 7900HT fast real-time PCR system (Life Technologies, USA). The real-time PCR cycling condition is 40 cycles of 95°C 5 sec, 60°C 30 sec [17 (link)]. The sequences of the RT-PCR primers (RiboBio, China) were as follows (5ʹ – 3ʹ): LGALS3BP (forward: 5ʹ-AGGTACTTCTACTCCCGAAGGA-3ʹ, reverse: 5ʹ-GGCCACTGCATAGGCATACA-3ʹ) and GAPDH (forward: 5ʹ-GGT GAA GGT CGG TGT GAA CGG ATT T-3ʹ, reverse: 5ʹ-AAT GCC AAA GTT GTC ATG GAT GAC C-3ʹ). The relative mRNA expression was calculated using the 2−ΔΔCt method and normalized to GAPDH expression.
4
Quantifying miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the RNeasy Mini Kit (Qiagen GmbH, Germany) and reverse transcribed into cDNA using the Prime Script RT Reagent Kit (TaKaRa, Japan). The RT-PCR primers for miR-135b-5p, miR-181b-5p, and U6 were purchased from RiboBio (China). The PCR primers for ITGA2 were 5′-GAGAACAACAGGTGACTT-3′ (forward) and 5′-CTCTCCTGTATGATGCTG-3′ (reverse). The PCR primers for GAPDH were 5′-AGAAGGCTGGGGCTCATTTG-3′ (forward) and 5′-GAAGACTGTGGATGGCCCCT-3′ (reverse). Real-time quantitative PCR assays were performed with SYBR Premix Ex Taq II (TaKaRa, Japan) at 95°C for 30 s, followed by 39 cycles of 95°C for 5 s and 60°C for 30 s. The expression levels of GAPDH and U6 were used as internal controls.
5
RNA Extraction and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA, including miRNA, was extracted using RNAiso Reagentreagent (Takara, Japan) according to the manufacturer's instruction. GABBR1 mRNA level was tested using SYBR PrimeScript RT‐PCR Kit (Takara) with the following primers: GABBR1 forward primer, 5′‐GAGGACGTGAATAGCCGCAG‐3′ and GABBR1 reverse primer, 5′‐CTGGATCACACTTGCTGTCGT‐3′. GAPDH forward primer, 5′‐CTGGGCTACACTGAGCACC‐3′, reverse primer: 5′‐AAGTGGTCGTTGAGGGCAATG‐3′. For miRNA analysis, the stem‐loop RT primer and the RT‐PCR primers for each individual miRNAs were purchased from Ribobio (Guangzhou, China). The relative expression of each individual miRNAs was normalized to that of the internal control U6.
6
Circular RNA PVT1 Regulation in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from 39 pairs of BC clinical specimens and adjacent normal specimens or BC cells using TRIzol reagent (Invitrogen, CA, USA). 10 μg total RNA isolation was separated by 2 U/μg RNase R (Epicentre Technologies) 30 min at 37℃. Random primers and stem-loop primers were used to synthesize cDNA using the TaKaRa system (Takara, Dalian, China). RT-PCR primers were purchased from RiboBio. CircPVT1-Forward: ATCGGTGCCTCAGCGTTCGG, circPVT1-Re-verse: CTGTCCTCGCCGTCACACCG; miR-140-3p-Forward: GCGCGTACCACA-GGGTAGAA, miR-140-3p-Reverse: AGTGCAGGGTCCGAGGTATT; TRPS1-For-ward: GTATCCTGCATCGGGAGAAA,TRPS1-Reverse: AGCTTCTGGTAGAGG-CCACA; β-actin-Forward: CTTAGTTGCGTTACACCCTTTCTTG, β-actin-Reverse: CTGTCACCTTCACCGTTCCAGTTT; Real-time PCR was detected by the CFX96 Tm Real-Time System (Bio-Rad, USA). The calculation method of relative expression was using the comparative Ct( 2 -ΔΔCt ) method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!