The expression of miRNAs was analyzed using quantitative reverse transcription PCR (qRT-PCR). Complementary DNA (cDNA) was synthesized using a PrimeScript™ RT reagent kit (TaKaRa RR037A, Dalian, China). Real-time PCR was performed using a real-time PCR kit (TaKaRa RR820A), followed by detection using a 7900HT fast RT-PCR instrument (Thermo Fisher Scientific), according to the manufacturer’s protocol. For the quantitative analysis of the expression of miRNAs, Bulge-Loop miRNA RT Primer was used. Bulge-Loop miRNA qRT-PCR primers were purchased from RiboBio (Guangzhou, China). The relative expression levels of miRNAs were normalized against that of U6. The expression levels were calculated using the 2−∆∆CT method. The qRT-PCR primer sequences were as follows: miR-132-3p: 5′-TAACAGTCTACAGCCAT-3′ (forward) and 5′-CAGTGCGTGTCGTGGAGT-3′ (reverse); U6 5′-ACCACAGTCCATGCCATCAC-3′ (forward) and 5′-TCCACCACCCTGTTGC TGTA3′ (reverse).
7900ht fast rt pcr instrument
Manufactured by Thermo Fisher Scientific
Sourced in Singapore
The 7900HT Fast RT-PCR instrument is a real-time PCR system designed for high-throughput gene expression analysis. It features a 96-well sample capacity and supports fast cycling protocols, enabling efficient and accurate quantification of target sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Primescript rt pcr kit, by Takara Bio (3 mentions)
Real time pcr kit, by Takara Bio (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Gene specific primers, by Roche (2 mentions)
Lightcycler 480 reagent kit, by Roche (2 mentions)
Rnaqueous kit, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Bulgeloop mirna qrt pcr primers, by RiboBio (1 mentions)
Bulge loop mirna qrt pcr primer, by RiboBio (1 mentions)
Hiscript 3 rt supermix kit, by Vazyme (1 mentions)
Paris kit, by Thermo Fisher Scientific (1 mentions)
Hieff qpcr sybr green master mix, by Yeasen (1 mentions)
Veriquest probe one step qrt pcr master mix, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Primetime qpcr assay, by Integrated DNA Technologies (1 mentions)
Primescript mirna cdna synthesis kit, by Takara Bio (1 mentions)
Sybr fast qrt pcr master mix kit, by Thermo Fisher Scientific (1 mentions)
Taqman probe, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
11 protocols using 7900ht fast rt pcr instrument
1
Quantitative Analysis of miRNA Expression
2
Quantification of mRNA and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription of mRNA and microRNA were performed with different primers. For mRNA analysis, cDNA was synthesized using a PrimeScript™ RT reagent kit (Takara RR037A). The real‐time PCR experiment was performed with the real‐time PCR kit (Takara RR820A), which was followed by detection using a 7900HT fast RT‐PCR instrument (Thermo Fisher Scientific) according to the manufacturer's protocol. For the quantitative analysis of miR‐132 expression, Bulge‐Loop miRNA RT Primer was used rather than Oligo dT primer and Random 6 mers in the PrimeScript™ RT reagent kit. Bulge‐Loop miRNA qRT‐PCR Primer was purchased by RiboBio (Guangzhou, China). The relative expression levels of the mRNA and miR‐132 were normalized with GAPDH (Sangon, shanghai, China) or U6, respectively. Expression levels were calculated using the 2−∆∆ CT method. The qRT‐PCR primer sequences for MMP‐9 were 5′‐GTCCCTGCTCTACAATGTCC‐3′ (forward) and 5′‐CTTCACTTCCGAGATCTCTTCC−3′ (reverse); the sequences for GAPDH were 5′‐ACCACAGTCCATGCCATCAC‐3′ (forward) and 5′‐TCCACCACCCTGTTGC TGTA−3′ (reverse).
3
mRNA Quantification of Cultured Neurons
4
Quantifying HOST2 mRNA Expression in Breast Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from MDA-MB-231, MDA-MB-468, HCC1937, MCF-7 and SKBR3 and MCF-10A cells by TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer’s protocol. cDNA was generated via reverse transcription using the PrimeScript RT-PCR kit in accordance with the manufacturer’s instructions (Takara Bio, Inc.). Subsequently, qPCR was performed on a 7900HT Fast RT-PCR instrument (Applied Biosystems; Thermo Fisher Scientific, Inc.). The primer sequences were synthesized by RiboBio (Guangzhou, China). HOST2, sense: 5′-GGACAGGTCCCTTGTTTCAA-3′, antisence: 5′- CTGGTCTTTCCTTGCCTCTG-3′; GAPDH, sense:5′- CCACTCCTCCACCTTTGAC − 3′, antisence: 5′-ACCCTGTTGCTGTAGCCA − 3′. The amplification protocol was as follows: Initial denaturation for 3 min at 95 °C, followed by 40 cycles of denaturation at 95 °C for 3 s, annealing at 65 °C for 30 s and elongation at 72 °C for 20 s. Expression of mRNAs or miRNAs was assessed by handling threshold cycle (CT) values. The relative expression levels were counted by a 2−ΔΔCt method.
5
RNA Extraction, Reverse Transcription, and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nuclear and cytoplasmic RNA was extracted individually by the PARIS™ Kit (Invitrogen, Carlsbad, CA, USA). Total RNA of cells and tissues was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The RNA concentration and purity were assessed with a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). Reverse transcription was applied to obtain cDNA using HiScript III RT SuperMix kit (Vazyme Biotech, Nanjing, China). qRT-PCR was conducted on a 7900HT Fast RT-PCR instrument (Applied Biosystems, Singapore). Hieff® qPCR SYBR® Green Master Mix, the reagent for qRT-PCR, was purchased from Yeasen (Shanghai, China). Primers were produced by Sangon Biotech (Shanghai, China). 18S rRNA, U6 snRNA, and β-Actin (ACTB) were regarded as internal calibrators for hsa_circ_0053063, miRNA, and mRNA respectively. Primers used in this article are presented in Supplementary Table 1 . The results of qRT-PCR were analyzed for relative quantitation using the 2-ΔΔCT method.
6
Temporal Expression of Cbln Genes in Mice
7
mRNA Quantification of Cultured Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For mRNA measurements of cultured neurons, RNA was isolated at DIV14 using the RNAqueous kit (Ambion). RT-PCR reactions were set up in duplicates for each condition (150 ng total RNA) using the LightCycler 480 reagent kit (Roche), gene-specific primers (Roche), and a 7900HT Fast RT-PCR instrument (Applied Biosystems) with GAPDH as internal control.
8
Quantitative Analysis of miRNA and mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells or tissues using the TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). cDNA was synthesized using the PrimeScript RT kit for mRNA and Prime-Script miRNA cDNA Synthesis kit (both Takara Bio, Inc.) for miRNA, according to the manufacturer's instructions. qPCR was carried out using the SYBR® FAST qRT-PCR Master Mix kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol on a 7900HT fast RT-PCR instrument (Applied Biosystems; Thermo Fisher Scientific, Inc.). The primer sequences were designed and synthesized by Guangzhou RiboBio Co., Ltd. The primer sequences were as follows: miR-497 forward, 5′-GTGCAGGGTCCGAGGT-3′ and reverse, 5′-TAGCCTGCAGCACACTGTGGT-3′; U6 forward, 5′-GCTTCGGCAGCACATATACTAAAAT-3′ and reverse, 5′-CGCTTCACGAATTTGCGTGTCAT-3′; YAP1 forward, 5′-AGAACAATGACGACCAATAGCTC-3′ and reverse, 5′-GTCGATGGCTAGTCGTAGCATCGAT-3′; and GAPDH forward, 5′-GCTTCGGCAGCACATATACTAAAAT-3′ and reverse, 5′-TGCTAGCTGGCATGCCCGATCGATC-3′. Relative mRNA and miRNA levels were normalized to GAPDH and U6, respectively, and were obtained from the threshold cycle (Cq) values using the 2−ΔΔCq method (25 (link)). qPCR parameters for mRNA and miRNA quantification were as follows: 2 min at 95°C, followed by 40 cycles of 30 sec at 95°C and 45 sec at 60°C. Each sample was tested in triplicate.
9
Quantitative RT-PCR Analysis of hESC Differentiation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
hESCs from various stages of directed differentiation were collected and RNA was extracted with the RNeasy Mini Kit (Qiagen). Reverse transcription was performed with the Clontech RT-PCR kit. RT-PCR was run on a 7900HT Fast RT-PCR instrument (Applied Biosystems) with Taqman probes for FEV (assay ID: Hs00232733_m1) and GAPDH (assay ID: Hs02758991_g1) in triplicate. Data were normalized to GAPDH. Error bars represent standard deviation.
10
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of tissues or cells was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions and it was converted into cDNA by PrimeScript™ RT-PCR kit according to the manufacturer's instructions (Takara, Tokyo, Japan). After the reverse transcription (RT) process, quantitative reverse-transcription polymerase chain (qRT-PCR) reaction was performed under the instruction of SYBR Green PCR Master Mix on a 7900HT Fast RT-PCR instrument (Applied Biosystems, Singapore). The amplification procedure was as follows: 95°C for 3 min, then 40 cycles at 95°C for 3 s, 60°C for 30°s and followed by 95°C for 15 s, 60°C for 15 s, and 95°C for 15 s. The relative expression of miRNA and that of mRNA were evaluated by threshold cycle (CT) value using the 2−∆∆Ct method. The U6 or β-actin was used as controls, respectively. Primer sequences are provided in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!