Restriction endonucleases, DNA polymerases and polynucleotide kinase were purchased from Enzynomics (Daejeon, Korea). Antibodies against hexahistidine (6XHis) epitope or glutathione-S transferase (GST) used for western blotting were from Qiagen (Valencia, CA, USA) and Santa Cruz Biotechnology (Santa Cruz, CA, USA), respectively. Secondary antibodies were from Amersham Biosciences (Piscataway, NJ, USA). Oligonucleotides used in this study were commercially synthesized by Genotech or Macrogen (Daejeon, Korea). All oligonucleotides were gel-purified prior to use. Nucleoside triphosphates were obtained from Sigma-Aldrich (St. Loius, MO, USA), and [γ-32P]ATP (>3000 Ci/mmol) was purchased from Perkin Elmer NEN (Waltham, MA, USA). The pRS plasmids were purchased from New England Biolabs (Beverly, MA, USA). The pET vectors used for protein expression in Escherichia coli were from Novagen (Darmstadt, Germany). Isopropyl β-D-1-thiogalactopyranoside (IPTG) was from ElpisBiotech (Daejeon, Korea). Imidazole (IDZ) was from Acros Organics (Geel, Belgium). The uracil analog, 5-fluoroorotic acid (5-FOA) and proteinase K were obtained from Duchefa Biochemie (Haarlem, Netherland). MMS was obtained from Sigma-Aldrich (St. Loius, MO, USA).
Nucleoside triphosphates
Manufactured by Merck Group
Sourced in United States
Nucleoside triphosphates are essential building blocks for the synthesis of nucleic acids, including DNA and RNA. They provide the necessary energy and raw materials for the enzymatic reactions involved in DNA replication, transcription, and other metabolic processes.
Automatically generated - may contain errors
Lab products found in correlation
Polynucleotide kinase, by Enzynomics (2 mentions)
Restriction endonucleases, by Enzynomics (2 mentions)
Imidazole idz, by Thermo Fisher Scientific (2 mentions)
Mgcl2, by Merck Group (2 mentions)
T4 dna ligase, by Thermo Fisher Scientific (2 mentions)
T4 dna ligase, by Enzynomics (1 mentions)
T7 rna polymerase, by Merck Group (1 mentions)
Dnase 1, by Thermo Fisher Scientific (1 mentions)
Nanodrop 8000, by Thermo Fisher Scientific (1 mentions)
T4 pnk, by Thermo Fisher Scientific (1 mentions)
Inorganic pyrophosphate, by Merck Group (1 mentions)
Dntp mixture, by Takara Bio (1 mentions)
Restriction endonuclease, by Thermo Fisher Scientific (1 mentions)
L thr, by Merck Group (1 mentions)
L ser, by Merck Group (1 mentions)
Pyrophosphatase ppiase, by Roche (1 mentions)
Rnase t1, by Thermo Fisher Scientific (1 mentions)
Phusion high fidelity dna polymerase, by New England Biolabs (1 mentions)
Tris base, by Merck Group (1 mentions)
Sodium chloride (nacl), by Merck Group (1 mentions)
6 protocols using nucleoside triphosphates
1
Protein Expression and Purification
2
Synthesis of Amino Acid Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides for cloning of LdmS and generation of LdmS variants were purchased from Sigma-Aldrich. Amino acids, amino acid analogs, and nucleoside triphosphates were of ≥90% purity and were obtained from Sigma-Aldrich, except for ʟ-Met sulfoxide and N-carbamoyl-ᴅʟ-Asp which were obtained from Sapphire Bioscience. Aqueous stock solutions of acidic amino acids/amino acid analogs, o-acetyl-ʟ-Ser, ʟ-Tyr, and ʟ-Trp were prepared by adjusting to ∼pH 7 with NaOH. Solutions of labile ʟ-amino acids o-acetyl-ʟ-Ser, ʟ-Cys, and ʟ-homoCys were prepared immediately prior to use. Phosphate standards were prepared from anhydrous potassium phosphate dibasic (KH2PO4; >99% purity).
3
Synthesis and Purification of Protein Complexes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The oligonucleotides used in this study were synthesized commercially by Bioneer and Genotech (Daejeon, Korea). Oligonucleotides longer than 30 nucleotides (nt) were gel-purified prior to use. The following proteins: Taq DNA polymerases, restriction endonucleases, T4 DNA ligase and polynucleotide kinase were purchased from Enzynomics (Daejeon, Korea). Nucleoside triphosphates were obtained from Sigma-Aldrich (St. Louis, MO, USA). [γ-32P] ATP (>5000 Ci/mmol) was purchased from IZOTOP (Budapest, Hungary). Isopropyl β-D-1-thiogalactopyranoside (IPTG) was from ElpisBiotech, Inc. (Daejeon, Korea) and imidazole (IDZ) was from Acros Organics (Geel, Belgium). The expression vectors (pET21d-MUS81/His-EME1 and pET21d-MUS81/His-EME2) used to prepare the MUS81–EME1/EME2 complexes were kindly provided by Dr Stephen C. West (London Research Institute, UK). In expression vectors, ‘His’ before the name of proteins indicates that hexahistidine tags were fused to the N-terminus of the expressed proteins.
4
In vitro Transcription of DvSnf7 RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
In vitro T7 RNA Polymerase-transcribed 968 nucleotide (nt) DvSnf7 RNA (IVT DvSnf7 RNA) was used to treat soil samples and serve as the reference standard for the QuantiGene 2.0 microplate assay [24] (link). This 968-nt transcript is produced in transgenic maize containing a DvSnf7 suppression cassette and was determined by cDNA sequencing to include a 240-nt inverted repeat region and adjacent 5′- and 3′ sequences. The 968-nt DvSnf7 fragment was amplified by PCR from the original plant transformation vector and cloned downstream of a synthetic T7 promoter sequence (TAATACGACTCACTATAGGG ) in pUC19 plasmid. The identity of the recombinant pUC plasmid template used to produce the IVT DvSnf7 RNA was verified by DNA sequencing. For IVT RNA synthesis, the pUC plasmid was linearized by BglII restriction digestion and incubated with nucleoside triphosphates (8 mM each, Sigma) and T7 RNA Polymerase in transcription buffer overnight at 37°C. The reaction was then treated with DNase I (100 units per 1 mL, Ambion) and extracted with phenol∶chloroform (1∶1 volume∶volume). The size of the IVT DvSnf7 RNA was confirmed by agarose gel electrophoresis and its concentration was determined using a NanoDrop 8000 (Thermo Scientific, Wilmington, DE) according to the manufacturer's instruction. Aliquots of the IVT DvSnf7 RNA sample were stored in a −80°C freezer.
+ Expand
In vitro T7 RNA Polymerase-transcribed 968 nucleotide (nt) DvSnf7 RNA (IVT DvSnf7 RNA) was used to treat soil samples and serve as the reference standard for the QuantiGene 2.0 microplate assay [24] (link). This 968-nt transcript is produced in transgenic maize containing a DvSnf7 suppression cassette and was determined by cDNA sequencing to include a 240-nt inverted repeat region and adjacent 5′- and 3′ sequences. The 968-nt DvSnf7 fragment was amplified by PCR from the original plant transformation vector and cloned downstream of a synthetic T7 promoter sequence (
5
Reagents for Molecular Biology Experiments
Check if the same lab product or an alternative is used in the 5 most similar protocols
l -Thr, l -Ser, dithiothreitol, nucleoside triphosphates (NTPs), guanosine monophosphate (GMP), tetrasodium pyrophosphate, Tris-base, MgCl2, NaCl and inorganic pyrophosphate were purchased from Sigma (St Louis, MO, USA). [14C]Thr was obtained from Biotrend Chemicals (Destin, FL, USA). [α-32P]ATP and [γ-32P]ATP were obtained from Perkin Elmer Inc. (Waltham, MA, USA). T4 DNA ligase, T4 PNK (polynucleotide kinase), RNase T1, RNase S1, and restriction endonucleases were obtained from Thermo Scientific (Pittsburgh, PA, USA). Phusion high-fidelity DNA polymerase was purchased from New England Biolabs (Ipswich, MA, USA). Ni2+-NTA (nitrilotriacetic acid) Superflow was purchased from Qiagen Inc. (Germany). Pyrophosphatase (PPiase) was obtained from Roche Applied Science (China). The dNTP mixture was purchased from Takara (Japan). Oligonucleotide primers were synthesized by Biosune (China). Escherichia coli Rosetta (DE3) cells were purchased from Stratagene (Santa Clara, CA, USA).
+ Expand
6
Genotyping Mice by PCR and Enzyme Digestion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice were genotyped by polymerase chain reaction (PCR) on tail biopsy samples using the following primers: forward, 5′-AGGCAGCGCCTTTGCTGCGTC-3′; reverse, 5′-TCCTGGTCACAGAGGTCCTTA-3′. PCR mix contained 1.0 μl of DNA, 0.2 μl of each primer, 0.4 μl of DreamTaq DNA Polymerase (Thermo Fisher Scientific, EP0703), and PCR buffer [containing tris-HCl (pH 8.8), ammonium sulfate (Sigma-Aldrich), MgCl2 (Sigma-Aldrich), 2-mercaptoethanol (Merck), EDTA (pH 8.0) (Sigma-Aldrich), nucleoside triphosphates (2′-deoxyadenosine 5′-triphosphate, 2′-deoxycytidine 5′-triphosphate, 2′-deoxyguanosine 5′-triphosphate, and 3′-deoxythymidine 5′-triphosphate) (Promega), bovine serum albumin (BSA; Ambion—Life Technologies), and H2O to a final volume of 20 μl]. PCR conditions were as follows: 3 min of initial denaturation at 94°C, followed by 36 cycles of 30-s denaturation at 94°C, 30-s annealing at 60°C, and 60-s elongation at 72°C. Final elongation was performed for 7 min at 72°C. Enzymatic digestion was performed with StyI (10 U/μl) (New England Biolabs, R0500S). The PCR product was separated by 3% gel electrophoresis (+/+ 600 bp, +/− 600 bp + 350 bp + 250 bp, −/− 350 bp + 250 bp).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!