Tadvanced thermocycler

SNP assays were designed and manufactured for 24 species-specific SNP markers using KASP (Kompetitive Allele-Specific PCR) genotyping technology by LGC Genomics Ltd. (Supplementary Table S3). In most cases, these were derived from the set of species including O. niloticus, O. mossambicus, O. aureus and O. u. hornorum, but some markers were selected only to distinguish O. mossambicus from O. niloticus and O. aureus (see Results). For primer design to be feasible, the SNP of interest at a given locus needed to be at least 20 bp from the end of a given sequence. This allowed enough sequence for compatible primers to be designed. Each sample was genotyped in a 5 µL reaction volume using 8 ng DNA template dried in a 96 well white PCR plate (Starlab). The PCR cycling conditions (TAdvanced thermocycler, Biometra) were as follows: an initial denaturation at 94 °C for 15 min, 10 cycles at 94 °C for 20 s and touchdown 65 °C to 57 °C (dropping 0.8 °C each cycle) for 1 min followed by 35 cycles at 94 °C for 20 s and 57 °C annealing/amplification. Fluorescence signals were measured at 22 °C using a Techne Quantica® Real Time PCR Thermal Cycler (Techne) and genotypes assigned by allelic discrimination analysis using the Quansoft software v1.121.

For the generation of the homologous recombination arms 100–200 ng DNA was amplified in a total volume of 20 μl. Mastermix was prepared at final concentrations of 1 × reaction buffer (BioTherm, Genecraft), 250 µM dNTPs (Thermo Fisher Scientific), 0.2 µM of each primer, 1 unit Taq DNA polymerase (BioTherm, Genecraft) and filled up to 20 µl with H₂O. After initial denaturation at 94 °C for 3 min PCR were run for 30 cycles (denaturation 94 °C for 30 s, annealing for 30 s at respective temperature, extension 68 °C for 1 min). PCR products were amplified in the Biometra TADVANCED thermocycler and separated in 1% TBE agarose gel containing 2.5 × GelRed Nucleic Acid Gel Stain (Biotium) for visualization. For the validation of SNCA-GFP-LUC-fusion, mRNA was converted into cDNA and amplified by using SNCAqF2 GGACCAGTTGGGCAAGAATG and HR150GFP reverse TGTCACGATCAAAGGACTCTGG primer. As a negative control for the wildtype locus we used SNCAqF2 and the corresponding reverse primer SNCAqR2 GGCACATTGGAACTGAGCAC.