The chromatin immunoprecipitation (ChIP) assay was performed using the Magna ChIP A/G Assay Kit (Millipore, CA, USA). Briefly, cells were crosslinked with 37% formaldehyde. The DNA/protein complexes were treated using TEAD4 and IgG (Cell signaling technology) antibodies and protein A/G magnetic beads. The precipitated chromatin complexes were purified and decrosslinked at 62°C for 2 h. The precipitated DNA fragments were quantified using PCR analysis. The primers for ChIP were listed as follows: SLC2A3 position1 forward, 5′ GTAATCTAGTTTTCTCGGGTCCAG3′; SLC2A3 position1 reverse, 5′ TTTCCCAGTGGTGAATTGGAG3′; SLC2A3 position2 forward, 5′CCACTGTGCCCAGGTCAAC 3′; SLC2A3 position2 reverse, 5′AGGGAAACCCCATCTCCAA 3′; BIRC5 position1 forward, 5′AAATCAGAGCTGGGGTCCAA3′; BIRC5 position1 reverse, 5′TGAAATCCCTGAGAAGCAGAGTG3′; BIRC5 position2 forward, 5′CTCTCACAGCCTTCTCTTGTCA 3′; and BIRC5 position2 reverse, 5′ CACCCCGAGGTACGATCAGT 3′.
Magna chip a g assay kit
Manufactured by Merck Group
Sourced in United States
The Magna ChIP A/G Assay Kit is a chromatin immunoprecipitation (ChIP) assay kit designed for the isolation and analysis of DNA-binding proteins and their associated genomic regions. The kit provides all the necessary reagents and protocols for performing ChIP experiments, including magnetic protein A/G beads for immunoprecipitation, buffers, and reagents for chromatin shearing and DNA purification.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using magna chip a g assay kit
1
ChIP Assay for Transcription Factor Binding
2
ChIP Assay for BCL2 Gene Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) assay was performed using the Magna ChIP A/G Assay Kit (Millipore). Briefly, cells were crosslinked with 37% formaldehyde. The DNA/protein complexes were treated using TEAD4 and IgG (Cell Signaling Technology) antibodies and Protein A/G magnetic beads. The precipitated chromatin complexes were purified and de‐crosslinked at 62℃ for 2 h. The precipitated DNA fragments were quantified using PCR analysis. The primers for ChIP were listed as follows:
BCL2 position1 forward, 5′ CGGACTAGGTGTTCAGGTGGA 3′,
BCL2 position1 reverse, 5′ CGCCTACACACACACACGTTG 3′;
BCL2 position2 forward, 5′ CCTGGGCAACATAGCAAAAGC 3′,
BCL2 position2 reverse, 5′ CTGTGCCCTGCCTGACATC 3′.
BCL2 position1 forward, 5′ CGGACTAGGTGTTCAGGTGGA 3′,
BCL2 position1 reverse, 5′ CGCCTACACACACACACGTTG 3′;
BCL2 position2 forward, 5′ CCTGGGCAACATAGCAAAAGC 3′,
BCL2 position2 reverse, 5′ CTGTGCCCTGCCTGACATC 3′.
3
ChIP Assay for ETS2 Transcription Factor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was performed by Magna ChIP A/G Assay Kit (Millipore, Bedford, MA) according to the manufacturer's instruction. HK2 cells were treated with TGF-β1 for 24 h and fixed with 1% formaldehyde in DMEM for 10 min.
Glycine was added to each dish and set for 5 min prior to washing in cold PBS two times. Cells were collected, resuspended, and sonicated to generate 200-800 bp DNA fragments. Immunoprecipitation was performed with IgG antibody (Cell Signaling, Beverly, MA) and ETS2 antibody (Santa Cruz, CA). Precipitated DNAs were measured by qRT-PCR using specific primers for either ETS binding sites or a non-ETS binding site on JUNB promoter. The sequences of specific primers are listed in Table 3.
Glycine was added to each dish and set for 5 min prior to washing in cold PBS two times. Cells were collected, resuspended, and sonicated to generate 200-800 bp DNA fragments. Immunoprecipitation was performed with IgG antibody (Cell Signaling, Beverly, MA) and ETS2 antibody (Santa Cruz, CA). Precipitated DNAs were measured by qRT-PCR using specific primers for either ETS binding sites or a non-ETS binding site on JUNB promoter. The sequences of specific primers are listed in Table 3.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!