In our study, two different platforms were used for single nucleotide polymorphism (SNP) genotyping. For stage 1, genotyping was performed by using the Illumina Omni 1 platform. The Sequenom iPLEX system (Sequenom, Inc., San Diego, CA, USA) was used in stage 2. Polymerase chain reaction and extension primers were designed using Mass ARRAY Assay Design 3.1 software (Sequenom, Inc.). Manufacture’s iPLEX Application Guide (Sequenom, Inc.) was performed for genotyping procedures. All of the genotyping reactions were performed in 384-well plates. Each plate included a duplicate for three or four participants selected at random, as well as six to nine negative controls in which water was substituted for DNA. The average concordance rate was 99.8%.
Omni 1 platform
Manufactured by Illumina
Sourced in United States
The Omni 1 platform is a high-throughput sequencing system designed for generating accurate and reliable sequencing data. It provides a streamlined workflow for sample preparation, sequencing, and data analysis.
Automatically generated - may contain errors
3 protocols using omni 1 platform
1
Efficient SNP Genotyping Workflow
2
Genotyping Protocol for GWAS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All of the genotype data used in our analysis were from the samples of our previous stage 1 genome-wide association analysis (GWAS) using the Illumina Omni 1 platform [26] . The polymerase chain reaction and extension primers were designed by Mass MRRAY Assay Design 3.1 software (Sequenom, Inc.). We performed all genotyping reactions in 384-well plates. Each plate included a duplicate for three or four subjects, selected at random, as well as six-to-nine negative controls, in which water was used instead of DNA. The average concordance rate was 99.8%.
3
SNP Genotyping in Acute Myeloid Leukemia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bone marrow (2 ml) from each AML patient was drawn into Vacutainer tubes containing EDTA and stored at −80°C, and 2 ml of peripheral blood from the control subjects was preserved using the same procedure. Subsequently, genomic DNA was isolated using the DNA isolation kit (Aidlab Biotechnologies, Beijing, China) and preserved at −80°C. SNP genotyping of AML was carried out using the SNaPshot Multiplex kit (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and the primers were shown as follows: Forward, ATAGCTGGGGCTATGCGATTTG and reverse, GTTGGGGAGGTCTTGAAGGAGA. The genotyping information of the controls was extracted from the FAMHES database and the Omni 1 platform (Illumina, Inc., San Diego, CA, USA) was used for genotyping. The methods used were as previously described (28 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!