Anti h3k9ac

Chromatin immunoprecipitation (ChIP) was performed using the ChromaFlash High‐Sensitivity ChIP Kit (EpiGentek, P‐2027) according to the manufacturer's instructions. Briefly, the cells were fixed by 1% formaldehyde for 10 min at room temperature to crosslink the protein and DNA. Lysis buffer was added, and the cells were centrifuged to collect the chromatin pellets, which were sonicated to generate DNA fragments fewer than 500 base pairs in length and then incubated with the specific antibody overnight at 4 °C. The antibodies in this study included anti‐PU.1 (1:100, Thermofisher Scientific, PA5‐17505), anti‐H3K4me1 (1:100, Abcam, ab8895), anti‐H3K4me3 (1:100, Abcam, ab8580), anti‐H3K9ac (1:100, EpiGentek, A‐4022‐050), and anti‐H3K27ac (1:100, Active motif, 39133). The enriched DPP4 DNA was pulled down by antibody, and qPCR was performed to quantitate DPP4 enrichment. The primers used for qPCR of DPP4‐F and DPP4‐R were AGACTGGCACAGTTTTCTGAG and CTTTCCCATCACCCTTGCTGT, respectively.

Antibodies were purchased from the following suppliers: anti-H3K9me2, anti-H3K27me3 and anti-H3K9ac (EpiGentek, Farmingdale, NY); anti-H3K4me3, anti-H3K4me1 and anti-β-actin (Abcam, Cambridge, UK); negative rabbit IgG (Cell Signaling Technologies); anti-PRDM1 (sc-66015, Santa Cruz Biotechnologies, Dallas, TX); anti-TP53 (P6874 from Sigma and sc-98 from Santa Cruz); anti-mouse HRP-conjugated and anti-tubulin (Sigma); and anti-FOXA1 from Santa Cruz. Recombinant human TP53 protein (ref. 506165) was obtained from Calbiochem (San Diego, CA). The inhibitor 5-aza-2′-deoxycytidine (5-aza-dC) was purchased from Sigma-Aldrich and dissolved in DMSO.