Col2a1

Manufactured by Thermo Fisher Scientific

Sourced in United States

Col2a1 is a gene that encodes the alpha 1 chain of type II collagen, a major structural component of cartilage. This gene is commonly used in research applications related to cartilage and connective tissue development and function.

Automatically generated - may contain errors

Lab products found in correlation

8 protocols using col2a1

Chondrocyte Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from dedifferentiated chondrocytes before encapsulation procedure, encapsulated chondrocytes cultured in alginate-based scaffolds, or the same cells maintained in micromass by using the RNeasy Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instruction. Total RNA was used for reverse transcription and stored at −80°C. Briefly, cDNA was synthesized from total RNA (500 ng) in a 20-µL reaction volume using the TaqMan High-Capacity cDNA Reverse Transcription kit (Applied Biosystems), as previously described (Lolli et al., 2014 (link)).
Gene expression analyses by RT-qPCR were performed for Col1A1, Col2A1, Aggrecan, and Col10A1 mRNA levels. The following Taqman probes were used: Col1A1 5′FAM-AAGACGAAGACATCCCACCAATCAC-NFQ3′, Col2A1 5′FAM-CCTGGTCTTGGTGGAAACTTTGCTG-NFQ3′, Aggrecan 5′FAM-CGCTGCCAGGGATCCTTCCTACTTG-NFQ3′, Col10A1 5′FAM-ATAAAGAGTAAAGGTATAGCAGTAA-NFQ3′ (Life Technologies, Carlsbad, CA, USA).
The CFX96™ PCR detection system (Bio-Rad, Hercules, CA, USA) was used, and results were calculated using the 2^−ΔΔCt method using glyceraldehyde 3-phosphate dehydrogenase as reference gene for normalization.

Angelozzi M., Penolazzi L., Mazzitelli S., Lambertini E., Lolli A., Piva R, & Nastruzzi C. (2017). Dedifferentiated Chondrocytes in Composite Microfibers As Tool for Cartilage Repair. Frontiers in Bioengineering and Biotechnology, 5, 35.

+ Open protocol

+ Expand

Quantifying NP Cell Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

To analyze gene expression, we harvested the NP cells/clusters on defined days. The total RNA was extracted from the NP cells/clusters using an RNeasy kit (Qiagen, Germantown, Maryland). The samples were homogenized in the guanidine isothiocyanate‐based proprietary component of the kit with 1% β‐mercaptoethanol (RLT buffer) using a handheld homogenizer pestle (Fisher Scientific) in accordance with the manufacturer's protocol. The samples were amplified with a reverse transcriptase (High Capacity cDNA Reverse Transcription Kit, Thermo Fisher). A gene expression master mix and fluorescent‐labeled specific primers (TaqMan, Thermo Fisher) were mixed, followed by qPCR (QuanStudio version 1.4, Applied Biosystems, Foster City, California). We measured the expression of the typical molecules aggrecan core protein (Acan) and collagen type‐II (Col2a1) and the minor molecule collagen type‐I (Col1a1) in the ECM of NP as well as a catabolic molecule in the NP matrix metalloproteinase‐13 (Mmp‐13). All expression levels were compared with an intrinsic control, glyceraldehyde 3‐phosphate dehydrogenase (GAPDH), in each experiment. The TaqMan primers were a Col1a1: Bt03225358_g1; Col2a1: Bt03251837_mH; Acan: Bt03212189_m1; Mmp‐13: Bt03214051_m1; and GAPDH: Bt03210919_g1 (Life Technology, Carlsbad, California). Expression Suite Software v1.0.4 was used to analyze the data.

Takeoka Y., Kang J.D, & Mizuno S. (2020). In vitro nucleus pulposus tissue model with physicochemical stresses. JOR Spine, 3(3), e1105.

+ Open protocol

+ Expand

SIRT1-Mediated Chondrocyte Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Articular cartilage samples were collected from each knee joint of postnatal day 7 control and Sirt1-KI mice. The epiphyseal chondrocytes were cultured in monolayers in 6-well plates (2 × 105 cells/well) for 48 h. After reaching 80% confluency, the chondrocytes were incubated for 24 h with or without 10 ng/mL interleukin 1 beta (IL-1β) (R&D Systems, Minneapolis, MN, USA). The concentration of IL-1β was chosen based on the previous study [15 (link)]. RNA was isolated using RNeasy Kit (Qiagen), and cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems). Real-time PCR analysis was performed using TaqMan assays to analyze the expression of Sirt1, Col2a1, Col10a1, Mmp-3, Mmp-13, Acan, Adamts-5, and Xist (Applied Biosystems) in duplicate for each sample, and the relative gene-expression levels were normalized to Gapdh expression levels as a reference control, based on the comparative cycle-threshold method (Table 2).

Yamamoto T., Miyaji N., Kataoka K., Nishida K., Nagai K., Kanzaki N., Hoshino Y., Kuroda R, & Matsushita T. (2021). Knee Osteoarthritis Progression Is Delayed in Silent Information Regulator 2 Ortholog 1 Knock-in Mice. International Journal of Molecular Sciences, 22(19), 10685.

+ Open protocol

+ Expand

Real-Time PCR Analysis of Chondrogenic Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

At the indicated time point of culture, scaffolds were retrieved, frozen in liquid nitrogen, minced with tissue grinder, homogenized in Trizol Reagent (Invitrogen) and RNA was isolated following standard procedure detailed elsewhere [29 (link)]. For qRT-PCR analysis, 40–50 ng of total RNA was added per reaction and assays were carried out in triplicate in an Eppendorf’s mastercycler realplex RT-PCR system (Eppendorf North America). GAPDH was used as an internal control. Relative gene expressions in US stimulated samples were analyzed using 2^−ΔΔC_T method with respect to control (non-stimulated) at every time point. Sequences of GAPDH (Bt03210917_g1), COL1A1 (Bt03225332_m1), COL2A1 (Bt03251843_g1), Aggrecan (Bt03212186_m1), COL10A1 (Bt03215581_m1) TGFβ1 (Bt04259485_m1) and TGFβ3 (Bt03272218_m1) are proprietary to Applied Biosystems Inc. and not disclosed. Custom designed primers and probe for SOX9 have the following sequence: forward primer (GAGACTGCTGAACGAGAG), reverse primer (CGGCTGGTACTTGTAGTC) and Taqman probe (TGGTCCTTCTTGTGCTGCACGC).

Thakurta S.G., Kraft M., Viljoen H.J, & Subramanian A. (2014). Enhanced depth-independent chondrocyte proliferation and gene expression in an ultrasound bioreactor and an assessment of ultrasound dampening in the scaffold. Acta biomaterialia, 10(11), 4798-4810.

+ Open protocol

+ Expand

Quantifying Chondrocyte Markers in Growth Plates

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from femoral growth plates was extracted with TRIzol reagent (Invitrogen) and reverse-transcribed using the High Capacity Reverse Transcription Kit (Applied Biosystems) according to the manufacturer’s instructions. TaqMan quantitative real-time PCR was performed in a QuantStudio3 (Applied Biosystems) using the following primers (Applied Biosystems): Col2a1 (Mm01309565_m1); Col10a1 (Mm00487041_m1); Mmp-13 (Mm00439491_m1); Vegfa (Mm00437306_m1); Acan (Mm00545794_m1); Runx2 (Mm00501584_m1). Target gene expression was calculated by normalizing to the housekeeping gene ribosomal protein S2, Mrps2 (Mm00475528_m1) using the ∆Ct method^{66 (link)}.

Warren A., Porter R.M., Reyes-Castro O., Ali M.M., Marques-Carvalho A., Kim H.N., Gatrell L.B., Schipani E., Nookaew I., O’Brien C.A., Morello R, & Almeida M. (2023). The NAD salvage pathway in mesenchymal cells is indispensable for skeletal development in mice. Nature Communications, 14, 3616.

+ Open protocol

+ Expand

Primary Mouse Chondrocyte Isolation and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary mouse epiphyseal chondrocytes were obtained from five- to seven-day-old mice as has previously been described.^{31 (link)} Chondrocytes were seeded on six-well plates (2 × 10⁵/well). After reaching 60% to 70% conﬂuency, cells were cultured with 0.1 ng/ml IL-1β (R&D Systems, Minneapolis, Minnesota) for 24 hours and then stimulated with different concentrations of SRT1720 (0 µM control, 0.5 µM) for 48 hours. RNA was isolated using a QIAGEN RNeasy Kit (QIAGEN Inc., Valencia, California) and cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Waltham, Massachusetts). Real-time polymerase chain reaction (PCR) for SIRT1, Col1a1, Col2a1, aggrecan, Adamts-5 and Mmp-13 (all Applied Biosystems) (Table I) was performed in duplicate for each sample to determine relative gene expression using glyceraldehyde 3-phosphate dehydrogenase (GADPH) (Applied Biosystems) as a housekeeping control and the comparative cycle threshold method.

Nishida K., Matsushita T., Takayama K., Tanaka T., Miyaji N., Ibaraki K., Araki D., Kanzaki N., Matsumoto T, & Kuroda R. (2018). Intraperitoneal injection of the SIRT1 activator SRT1720 attenuates the progression of experimental osteoarthritis in mice. Bone & Joint Research, 7(3), 252-262.

+ Open protocol

+ Expand

Histological Analysis of Knee Joints

Check if the same lab product or an alternative is used in the 5 most similar protocols

Knee joints were harvested and fixed in 10% neutral buffered formalin for 3 days, decalcified in Formic Acid Bone Decalcifier (Immunocal, Decal Chemical Corp.) for 7–10 days, paraffin processed, and embedded for sectioning. Tissues were sectioned at 5 µm and stained with ABH/OG. IHC analyses were performed on sections using traditional antigen retrieval and colorimetric development methodologies with the following primary antibodies: SOX9 (Santa Cruz), COL2A1 (Thermo Scientific), COL10A1 (Quartett), COL1A1 (Abcam), COL3A1 (Abcam), MMP-13 (Thermo Scientific), IL6 (Abcam), and phosphorylated STAT3 (Cell Signaling). TUNEL cell death assay was performed on sections using the in situ Cell Death Detection Kit, Fluorescein (Roche) according to the manufacturer’s instructions. IF analysis and β-galactosidase staining was performed on frozen sections. Knee joints were harvested and fixed in 4% paraformaldehyde (PFA) for 2 hours at 4 °C and decalcified with 14% EDTA at 4 °C for 10 days. Tissues were washed in sucrose gradient, embedded with Tissue-TEK OCT medium, snap frozen in liquid nitrogen and sectioned at 10 µm using a Lecia CM 1850 cryotome. The NOTCH1 primary antibody (Santa Cruz) was used for IF analysis. Beta-galactosidase staining was performed as previously described (63 (link)).

Liu Z., Chen J., Mirando A., Wang C., Zuscik M.J., O’Keefe R.J, & Hilton M.J. (2015). A Dual Role for NOTCH Signaling in Joint Cartilage Maintenance and Osteoarthritis. Science signaling, 8(386), ra71.

+ Open protocol

+ Expand

Limb Tissue Preparation and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Embryos were harvested in cold 1× PBS, fixed in 4% paraformaldehyde (PFA), the limbs were dissected and then hand processed. Limbs were embedded in OCT for frozen sectioning and paraffin for standard microtomy and IHC or histologic staining. Frozen sections were cut at 10μm, while paraffin sections were cut at 5μm. To analyze the general cellular morphology, standard histological staining using ABH–OG was performed. IHC was performed on paraffin sections using the VectaStain ABC kits and developed with ImmPACT DAB (Vector Labs). Primary antibodies against the following proteins were used for IHC analyses: ACAN (1:200; Chemicon), COL2A1 (1:100; Thermo Scientific), SOX9 (1:100; Santa Cruz Biotechnology), and PH3 (1:200; Cell Signaling). Immunohistochemistry for BrdU (Invitrogen) was performed as previously described[62 (link)].

Sharma D., Mirando A.J., Leinroth A., Long J.T., Karner C.M, & Hilton M.J. (2021). HES1 is a novel downstream modifier of the SHH-GLI3 Axis in the development of preaxial polydactyly. PLoS Genetics, 17(12), e1009982.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!