Rnaiso plus reagent

Excised tissues (leaves and roots) were immediately frozen in liquid nitrogen and stored at −80 °C until gene expression analysis. Total RNA was extracted using a RNAisoTM Plus reagent (TaKaRa, Tokyo, Japan). The obtained RNA sample was treated with RNase-free DNase I, then MMLV-reverse transcriptase (Promega) was used to synthesize the first strand cDNA. Quantitative real time RT-PCR was performed using the SYBR Green PCR Master Mix (TaKaRa, Tokyo, Japan) in the QuantStudio 6 Flex real-time PCR detection system (Thermo Fisher Scientific, Waltham, MA, USA) with appropriate primers. Relative expression of genes compared to ACTIN was calculated using the ΔΔCt method [81 (link)].
The primers used to quantify gene expression were: GmACTIN, 5′-ATCTTGACTGAGCGTGGTTATTCC-3′ and 5′-GCTGGTCCTGGCTGTCTCC-3′; GmPHR25, 5′-AAAGGCCGACAAGAAAGAAACAGG-3′ and 5′-AACCACCGCTACAGCACCAGAAC-3′; GmEXPB2, 5′-TACCCTCCTCTTGTTTCAACCCT-3′ and 5′-AGCACCACCTTCACTACCGTCC-3′; GmYUCCA14, 5′-GATCTTCCATCCTTGGAGGC-3′ and 5-GCAACAGTATGCACTTGACCTTAC-3′; GmTIR1C, 5′-GGTGACAAGGCCCTTTTG-3′ and 5′-CTCACCGAGCAGGAGGAC-3′;

For insight into transcriptional responses of all ENA and NK genes to ambient pH and Na⁺/K⁺ cues, the WT cultures were prepared by incubating 100 aliquots of a 10⁶ conidia/ml suspension in CDB (3% sucrose, 0.3% NaNO₃, 0.1% K₂HPO₄, 0.05% KCl, 0.05% MgSO₄ and 0.001% FeSO₄) at optimal 25°C for 3 days on a shaking bed (150 rpm). Initial pH of CDB was adjusted to 6.0, 7.0, 8.0 and 9.0 respectively or to 7.0 after NaCl or KCl was added to the final concentration of 0.4 M. Total RNAs were extracted from the different cultures with RNAiso^TM Plus Reagent (TaKaRa, Dalian, China) and reversely transcribed into cDNAs with PrimeScript^RT reagent kit (TaKaRa). Three cDNA samples derived from the cultures of each treatment were used as templates to assess transcript levels of each target gene via real-time quantitative PCR (qPCR) with paired primers (Supplementary Table S2) under the action of SYBR_Premix ExTaq^TM (TaKaRa). Transcripts were normalized using γ-actin gene transcript as a reference. A threshold-cycle (2^−ΔΔCt) method was used to compute relative transcript levels of each gene in the WT cultures under acidic, alkaline and Na⁺/K⁺ stresses with respect to the standard at pH 7.0.

Total RNAs were extracted from A. niger RAF106 grown in TC medium with/without extra NaNO₃, NH₄Cl, peptone, or yeast at 30°C for 48 h by shaking at 150 rpm using RNAiso^TM Plus Reagent (TaKaRa, Dalian, China) and transcribed reversely into cDNA with PrimeScript^® RT reagent kit (TaKaRa). Each cDNA were used as templates to analyze the transcriptional expression of tested genes via qRT-PCR with paired primers with SYBR^® Premix Ex Taq^TM (TaKaRa) (Supplementary Table S1). The relative transcription level of each gene was defined as the fold changed ratio of its transcript of cells obtained from TC medium with a certain nitrogen source over that from TC medium using the 2^–ΔΔCt method (Livak and Schmittgen, 2001 (link)).

The transcriptional analyses for the genes were performed as reported previously [21 (link)]. The wild type strain was cultured on a SDAY plate, and the mycelia were sampled at the indicated time point. The total RNA was extracted from the mycelial samples with RNAiso^TM Plus Reagent (TaKaRa, Dalian, China) according to the manufacturer’s protocol. The cDNA was reverse transcribed using the PrimeScript^® RT reagent Kit (TaKaRa) and used as templates to perform the qRT-PCR reaction on a Mastercycler^® EP Realplex (Eppendorf, Hamburg, Germany) cycler. All primers are shown in Table S1. The relative expression level of each gene was calculated as the relative expression of different time points over 2 d using the 2^−∆∆CT method [22 (link)]. Fungal 18S rRNA was as an internal reference.

A9 and SMAF were selected to construct small RNA and cDNA libraries of asexual and sexual stage, respectively. Total RNA was extracted using the RNAiso Plus reagent (Takara, Shiga, Japan) according to the manufacturer’s instructions and then treated with RNase-free DNase I. RNA concentration was then evaluated by a NanoDrop ND-2000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, United States) and Agilent 2100 Bioanalyzer (Agilent, United States). Small RNAs (15–30 nt) were extracted from total RNA on a 15% denaturing polyacrylamide gel and ligated to specific 5′ adaptor and 3′ adaptor samples. After reverse transcription, the cDNA libraries were sequenced (PE100) on an Illumina HiSeq 2000 platform (BGI, Shenzhen, China). For each strain, three biological replicates were used and raw data were deposited in the NCBI Sequence Read Archive database with accession code PRJNA496418.

Total RNA were extracted by RNAiso Plus reagent (TaKaRa, Dalian, China). Quantitative real-time PCR (qRT-PCR) analysis for determination of mRNA was performed by using one step SYBR PrimeScript^TM RT-PCR Kit (TaKaRa). The expression of β2-microglobulin (B2M) was used as the internal control. The sequence of primers for Ars2 were forward, GGTGACCTTCGACCGCAGTGTT; and reverse, TGGGTGATGCCGTTGATGTTGC. Primers for p27kip1 were forward, TAACCCGGGACTTGGAGAAG; and reverse, GCTTCTTGGGCGTCTGCTC. Primers for pri-miR-6734-3p were forward, TCTTGCAGATGGTTCGGGTG, and reverse, ACCCTTTCCCATAGTGGCCT. Primers for B2M were forward, CCTTGAGGCTATCCAGCGT; and reverse, CCTGCTCAGATACATCAAACATG. The levels of miRNA were determined by using Bulge-Loop^TM miRNA qRT-PCR system (Ribobio, Guangzhou, China) according to the manufacturer’s instructions. Primers of miRNAs (miR-6734-3p, miR-3751-3p, miR-101-5p, miR-449-5p, miR-548ah-3p, miR-548am-3p, miR-455-5p, miR-744-3p, miR-30e-3p, miR-34c-5p and U6) were designed RIBOBIO Corporation (Guangzhou, China). U6 small nuclear RNA was used as the internal control.