Si snhg5

Small interfering RNAs (siRNAs) for SNHG5 and ZEB1 and control siRNA were provided by RiboBio. The siRNA sequences were as below: si‐SNHG5, 5′‐AGUAAUAACAAAAAGGAACAU‐3′; si‐ZEB1, 5′‐GGATAAAGAGATGGAAGAA‐3′. miR‐205‐5p mimic, NC mimic, miR‐205‐5p inhibitor and NC inhibitor were also provided by RiboBio. A SNHG5 overexpression vector (pcDNA3.1/SNHG5) and empty vector (pcDNA3.1/Control) were obtained from GeneChem Co.. Vectors containing short hairpin RNAs targeting SNHG5 (sh‐SNHG5) and negative control vector (sh‐NC) were also provided by GeneChem Co.. The sequences of sh‐SNHG5 and SNHG5 overexpressing vectors are listed in Table S1. Lipofectamine 2000 (Invitrogen) was used to transfect the above RNA oligoribonucleotides or constructs into ccRCC cells following the manufacturer's recommendation.

Small interfering RNA (siRNA) of SNHG5 (si‐SNHG5), siRNA of NC, mir‐205‐5p mimics and NC were designed by RiboBio. si‐SNHG5 and mir‐205‐5p mimics were cloned into the promoter CMV (Cytomegalovirus) expression vector (Invitrogen) following the manufacturer's instructions, and then transferred to large artery smooth muscle cells. All SNHG5 knockout constructs were acquired from RiboBio. SNHG5 overexpression plasmid (pcdna‐SNHG5) was constructed by cloning the full‐length complementary DNA (cDNA) sequence of SNHG5 into pcDNA3.1 vector (Invitrogen). mir‐205‐5p overexpression plasmid (pcdna‐mir‐205‐5p) was obtained by cloning the full‐length cDNA sequence of mir‐205‐5p into pcDNA3.1 vector (Invitrogen). si‐mir‐205‐5p and SMAD4 mimics were cloned into promoter CMV (Cytomegalovirus) expression vector (Invitrogen) and transfected into arterial smooth muscle cells following the manufacturer's instructions.