Sybr green master mixture

RNA was isolated using the NucleoSpin RNA II kit (Macherey-Nagel GmBH & Co., Dueren, Germany). cDNA synthesis was performed using the First Strand cDNA Synthesis kit (Fermentas, St. Leon-Rot, Germany). Real-time quantitative PCR was carried out with SYBR green master mixture (Promega, Madison, WI, USA) using Mx3005P Real-Time PCR system (Agilent, Santa Clara, CA, USA). Results were normalized to β-actin. Primers sequences are available upon request.

Total RNA extraction from tumor cells was prepared as instructed by the manufacturer using TRIzol^® reagent (Invitrogen, Australia). Reverse transcription reactions were performed with oligo-dT primer using the High-Capacity cDNA RT Kit (Applied Biosystems). Real-time PCR was carried out with SYBR green master mixture (Promega) on a Rotor-Gene RG-3000 (Corbett Research, Australia) with the program pre-heating 95°C 5 min; then 40 cycles of 94°C 15 s; 60°C 15 s; and 72°C 20 s. The primers are: GAPDH, Forward: 5′-CTT​TTG​CGT​CGC​CAG-3′, Reverse: 5′-TTG​ATG​GCA​ACA​ATA​TCC​AC-3’; CD133, Forward 5′-CAC​CAA​GCA​CAG​AGG​GTC​AT-3′, Reverse 5′-CAC​TAC​CAA​GGA​CAA​GGC​GT-3’; TGF-β1, Forward 5′-CAA​CAA​TTC​CTG​GCG​ATA​CC-3′, Reverse 5′-GAA​CCC​GTT​GAT​GTC​CAC​TT-3’; Lgr5, Forward 5′- GAT​GTT​GCT​CAG​GGT​GGA​CT-3′, Reverse 5′- GGG​AGC​AGC​TGA​CTG​ATG​TT-3’; K-Ras, Forward 5′-TGT CAA​GCT​CAG​CAC​AAT​CTG, Reverse 5′-GGT​AGG​GAG​GCA​AGA​TGA​CA; Ki-67: Forward 5′-AAT​TCA​GAC​TCC​ATG​TGC​CTG​AG-3′, and Reverse 5′-CTT​GAC​ACA​CAC​ACA​TTG​TCC​TCA​GC-3′. The GAPDH primers were used as the internal control to normalize other gene expressions. The normalized expressions of treated samples were then used to calculate fold changes by dividing the expression of the control sample.

Total RNA extraction from mammosphere cells was prepared as instructed by the manufacturer using TRIzol® reagent (Invitrogen, Australia). Reverse transcription reactions were performed with oligo-dT primer using the High Capacity cDNA RT Kit (Applied Biosystems). Real-time PCR was carried out with SYBR green master mixture (Promega) on a Rotor-Gene RG-3000 (Corbett Research, Australia) with the program pre-heating 95 °C 10 min; then 40 cycles of 94 °C 15 s; 58 °C 30 s; and 72 °C 45 s. The primers were: TGF-β-1: F 5′-CAACAATTCCTGGCGATACC, R 5′-GAACCCG TTGATGTCCACTT; TGF-β-2: F 5′-GAGTGCCTGAACAACGGATT, R 5′-TGCAGCAGGGACA GTGTAAG; TGF-β-3: F 5′-GCAACTTGGAGGAGAACTGC, R 5′-CTGTGGGTTGTGTCTGC ACT; LIF: F 5′-CCCTGTCGCTCTCTAAGCAC, R 5′-ATCCTGGACAAGGGTGAGTG; H-Ras: F 5′-GTGGTCATTGATGGGGAGAC, R 5′-ACGTCATCCGAGTCCTTCAC; K-Ras: F 5′-TGT CAAGCTCAGCACAATCTG, R 5′-GGTAGGGAGGCAAGATGACA; ERBB2: F 5′-GACATTGACGAGACAGAG, R 5′-ACACAGTCACACCATAAC; ESR1: F 5′-CACATCAGGCACATGAGTAACAA, R 5′-TCCAGCAGCAGGTCATAGAG; SHP1: F 5′ TTTCAAGAAGACGGGGATTG, R 5′ CGGACTCCTGCTTCTTGTTC; SHP2: F 5′ AGAGCCACCCTGGAGATTTT, R 5′ CTCCTCCACCAACGTCGTAT. The internal control was 18S rRNA (F: 5′-CCATCGAACGTCTGCCCTA; R: 5′-TCACCCGTGGTCACCATG) is used to normalize target gene expression.