Synergy h1 spectrophotometer

Total RNA was isolated from cell lines using TRIzol reagent (Invitrogen, USA). RNA concentration was determined using a Synergy^™ H1 spectrophotometer (BioTek Instruments, Inc., USA). Reverse transcription was performed using Prime Script RT Master Mix (Transgen Biotech, Beijing, China). qRT-PCR was performed with SYBR Premix Ex Taq (TaKaRa Bio., Beijing, China) using Applied Biosystems Quant Studio 5 (Thermo Fisher Scientific, Shanghai, China). Fold changes in Nrf2 expression were calculated using the 2^−ΔΔCt method and normalized to β-actin expression. The primers are presented as Table 2.Table 2

Sequence Information

Name	Sequence (5′ → 3′)
human Nrf2-F	CCAATTCAGCCAGCCAGCACAT
human Nrf2-R	CAGGTGACTGAGCCTGATTAGTAG
human β-actin-F	CATGTACGTTGCTATCCAGGC
human β-actin-R	CTCCTTAATGTCACGCACGAT

This model determines the ability of the obtained plant powders to inhibit a specific reaction when methylglyoxal reacts with the guanidino group of arginine. The MGO solution (60 mmol/L; 0.5 mL) was added to 0.5 mL extracts dissolved in PBS and incubated at 37 °C for 2 h at 110 rpm. After this time, arginine solution (60 mmol/L; 0.5 mL) was added to each sample and incubated again under the same conditions for 7 d. The PBS (without the addition of Rosa canina powder extracts) was used as a blank. An aminoguanidine solution (30 mmol/L) served as a positive control instead of the extracts dissolved in PBS. The blank and positive control were subjected to the same procedure as the samples with the plant extracts. Fluorescence was measured with a Synergy H1 spectrophotometer (BioTek Instruments Inc., Santa Clara, CA, USA), at excitation wavelength λ = 340 nm and emission wavelength λ = 380 nm. The analysis was performed in quadruplicate (n = 4) and the results were expressed as a percentage of the AGE inhibition according to the equation in the BSA-glucose/fructose model.

Protein concentration was determined by the Bradford method using a Bradford reagent (Bradford Reagent, Sigma-Aldrich) according to the manufacturer’s instructions (Bradford 1976). Measurements were made in 96-well plates using a Synergy™ H1 spectrophotometer (BioTek, Winooski, VT, USA). To the samples containing 5 µL of protein solution, 250 µL of Bradford’s reagent was added. The whole mixture was incubated for about 20 min at room temperature and the absorbance was measured at 595 nm. Wells containing only Bradford’s reagent were treated as blank. Protein concentration in the samples was determined on the basis of a standard curve made of bovine serum albumin (BSA) solutions.

Thioflavin T (ThT) was from Fluka. CDy11, BoDipy-Oligomer (BD-oligo) and MK-H4 were kind gifts from Dr. Young-Tae Chang, Pohang University of Science and Technology, Korea. A 2 mM stock solution of ThT was prepared in TRIS buffer (25 mM TRIS 200 mM NaCl pH 8). Stock solutions of CDy11, BD-oligo, and MK-H4 were 1 mM each in 10% DMSO. For ThT assays, 10 μL of each protein sample (1 mg/mL) were mixed with 70 μL of ddH₂O and 20 μL of 20 μM of ThT stock solution (final [ThT] = 4 μM). For CDy11, BD-oligo, and MK-H4 assays, 10 μL of each protein sample (1 mg/mL) were mixed with 80 μL of ddH₂O and 10 μL of 100 μM of dye (final [dye] = 10 μM). Samples were added to 96-well all-black flat-bottom Microfluor plates and incubated in the dark for 15–30 min at room temperature. Fluorescence intensities of dyes were measured using a BioTek Synergy 2 or Synergy H1 spectrophotometer at the following emission and excitation wavelengths: ThT (Ex = 440, Em = 485), CDy11 and BD-Oligo (Ex = 530, Em = 580), and MK-H4 (Ex = 475, Em = 567). All experiments were performed in triplicate with background dye fluorescence subtracted from protein plus dye samples.

RNA from quadriceps was isolated using the miRNeasy Mini kit (Qiagen, Valencia, CA, USA) and following the protocol provided by the manufacturer. RNA was quantified by using a Synergy H1 spectrophotometer (Biotek, Winooski, VT, USA). RNA integrity was checked by electrophoresis on 1.2% agarose gel containing 0.02 mol/L morpholinopropanesulfonic acid and 18% formaldehyde. Total RNA was reverse transcribed to cDNA by using the Verso cDNA kit (Thermo Fisher Scientific, Waltham, MA, USA). Transcript levels were measured by Real-Time PCR (Light Cycler 96, Roche, Indianapolis, IN, USA) taking advantage of the TaqMan gene expression assay system (Life Technologies, Carlsbad, CA). In particular, expression levels for Atrogin-1 (Mm00499523_m1), MuRF-1 (Mm01185221_ m1), Fbxo21 (SMART; Mm01208074_ m1), Fbxo30 (MUSA1; Mm01191299_ m1), Fbxo31 (Mm00505343_m1), TGF-β1 (Mm1178820_m1), TGF-β2 (Mm00436955_ m1), myostatin (Mm01254559_m1), Activin A (Mm00434339_ m1), MyoD (Mm00440387_m1), Myogenin (Mm00446194_m1) and Pax-7 (Mm01354484_m1) were detected. Gene expression was normalized to TBP (Mm01277042_m1) levels using the standard 2^−ΔCT methods.