Steponeplus pcr machine

Manufactured by Thermo Fisher Scientific

Sourced in United States

The StepOnePlus Real-Time PCR System is a compact, easy-to-use instrument designed for fast and reliable real-time PCR analysis. It features a 96-well block format and can perform a wide range of real-time PCR applications, including gene expression analysis, SNP genotyping, and pathogen detection.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

StepOnePlus (2314 citations) StepOnePlus real-time PCR machine (381 citations) StepOnePlus machine (194 citations) StepOnePlus RT-PCR machine (32 citations) PCR machine (27 citations) ABI StepOnePlus Real-Time PCR machine (26 citations) StepOnePlus Real-Time PCR System machine (12 citations) StepOnePlus qRT-PCR machine (8 citations) Applied Bioscience StepOnePlus qRT-PCR machine (4 citations) StepOnePlus™ Real-Time PCR thermocycler machine (2 citations)

42 protocols using steponeplus pcr machine

Quantitative Analysis of Bone Repair Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the fracture callus (n=6 per group, 14 days
post-fracture) using the SV Total RNA Isolation System (Promega, Madison,
Wisconsin, USA) following the manufacturer’s instructions. Complementary DNA
(cDNA) synthesis was performed with 1 μg RNA using the High Capacity cDNA
Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) following
the manufacturer’s instructions. TaqMan^® gene expression assays
(Applied Biosystems, USA) were used for quantifying Collagen Type I
Alpha 1 Chain (Col1a1) (assay ID: Rn01463848_m1),
Runt Related Transcription factor 2(Runx2) (Rn01512300_m1), Osterix(Rn02769744_s1), and Sost (Rn00577971_m1) expression by
quantitative PCR on an StepOnePlus PCR machine (Applied Biosystems) and were
normalized to the expression of the reference gene Gapdh(Rn01775763_g1). Samples were run in duplicate, and relative expression was
calculated using 2^−ddCT, the ddCt was calculated as
dCt[goi_Res − ref_Res] − dCt[goi_Con −
ref_Con] where goi is the gene of interest and
ref is the reference gene. For descriptive and statistical
analyses, ddCT was applied as a continuous variable. Minimum information for
publication of quantitative real-time PCR experiments (MIQE) guidelines was
followed for designing and interpreting the results of quantitative real-time
PCR²¹.

Botega I.I., Zamarioli A., Guedes P.M., da Silva R.A., Issa J.P., Butezloff M.M., Sousa Y.T., Ximenez J.P, & Volpon J.B. (2019). Bone callus formation is highly disrupted by dietary restriction in growing rats sustaining a femoral fracture. Acta Cirúrgica Brasileira, 34(1), e20190010000002.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Liver Gene Expression

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from frozen liver that had been homogenized in TRI Reagent (Ambion Diagnostics, Austin, TX, USA), using the RNeasy Mini Kit (Qiagen N.V., Hilden, Germany). RNA concentration and purity were confirmed using a Nanodrop spectrophotometer (Thermo Scientific, Waltham, MA, USA), and reverse transcription PCR was carried out using the High Capacity cDNA reverse transcription kit (Applied Biosystems, Waltham, MA, USA). Quantitative polymerase chain reaction (qPCR) was carried out using SYBR Green dye and the StepOne Plus PCR machine (Applied Biosystems). Primers were designed using Primer3 [22 (link)] to the rat genome; primer sequences and GenBank references are included in Supplementary Table S1. Primers were designed to be intron-spanning to avoid amplification of genomic DNA. Product sizes and primer specificity were confirmed using classical PCR and gel electrophoresis before qPCR and melt-curves following qPCR. All qPCR results were adjusted to two reference genes (RPLP0 and GAPDH) using GeNorm for Microsoft Excel [23 (link)] and are presented as fold change in arbitrary units relative to the Gen0-C group, according to the 2^−ΔΔCT method [24 (link)].

Song A., Astbury S., Hoedl A., Nielsen B., Symonds M.E, & Bell R.C. (2017). Lifetime Exposure to a Constant Environment Amplifies the Impact of a Fructose-Rich Diet on Glucose Homeostasis during Pregnancy. Nutrients, 9(4), 327.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

After inducing differentiation, cells were harvested at different time points. Total RNA from (both treated and control wells) the cultured cells were isolated using RNAiso Plus (Takara). RNA quality and quantity were assessed by Nanodrop UV-VIS spectrophotometer (Thermo Fisher Scientific). Two micrograms of total RNA from each sample was reverse transcribed to cDNA using Prime Script RT reagent kit (Takara). Using SYBR Premix Ex Taq (Tli RNase H Plus, Takara), RT-qPCR was performed on Applied Biosystems Step one plus PCR machine. The RNA 18S gene was amplified as an internal standard reference gene (invariant control). Fold changes in the target gene expression were normalized to 18S ribosomal RNA gene expression using comparative CT method (2^−ΔΔCT method) (Schmittgen and Livak, 2008 (link)).

Chaudhari N., Talwar P., Lefebvre D'hellencourt C, & Ravanan P. (2017). CDDO and ATRA Instigate Differentiation of IMR32 Human Neuroblastoma Cells. Frontiers in Molecular Neuroscience, 10, 310.

+ Open protocol

+ Expand

Quantitative RT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared using Tri Reagent^® (Sigma-Aldrich) following manufacturer's instructions. 1 μg RNA was reverse transcribed using ImProm- II^™ Reverse Transcriptase (Promega, Madison, WI, USA) and quantitative RT-PCR was performed using SYBR-green PCR MasterMix (Applied Biosystems, Waltham, MA, USA) in a StepOne Plus PCR machine (Applied Biosystems). Fold change expression was determined by the comparative Ct method (ΔΔCt) normalized to 60S Ribosomal protein L19 expression. qRT-PCR data are represented as fold increase relative to non-treated cells (Control), which were assigned to 1. Primers for quantitative RT-PCR are listed in Supplementary Table 2.

Bazzani L., Donnini S., Finetti F., Christofori G, & Ziche M. (2017). PGE2/EP3/SRC signaling induces EGFR nuclear translocation and growth through EGFR ligands release in lung adenocarcinoma cells. Oncotarget, 8(19), 31270-31287.

+ Open protocol

+ Expand

Quantification of Cytokine mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

The small molecules were used at concentrations representing the EC₇₅ values and were co-stimulated with either 200 ng Pam3CSK4 (Invivogen), 25 µg poly(I:C) or 100 ng lipopolysaccharide (Sigma-Aldrich) at the cell counts and conditions previously described for the cellular luciferase assays. Cells were harvested 24 h post-transfection, washed with PBS, and RNA was extracted using Trizol (Ambion) and chloroform (Sigma-Aldrich). In all, 1–2 µg of total RNA was reverse-transcribed using random hex primers and SuperScript III (Life Technologies) into cDNA. Real-time PCR was carried out with 1× FastSYBR Green Plus Master Mix (Applied Biosystems) and run on an Applied Biosystems StepOne Plus PCR machine. The expression of mRNAs repressing murine Actb1 and Il-6 were measured (see Supplementary Table 5 for primer sequences used). Target C_T values were normalized to Actb1 C_T values and used to calculate ΔC_T. mRNA expression of target genes were then calculated using the ΔΔC_T method (2^ΔΔCT). Expression values were analyzed as described in the method for cellular luciferase assays.

Vincent J., Adura C., Gao P., Luz A., Lama L., Asano Y., Okamoto R., Imaeda T., Aida J., Rothamel K., Gogakos T., Steinberg J., Reasoner S., Aso K., Tuschl T., Patel D.J., Glickman J.F, & Ascano M. (2017). Small molecule inhibition of cGAS reduces interferon expression in primary macrophages from autoimmune mice. Nature Communications, 8, 750.

+ Open protocol

+ Expand

Western Blotting and RT-qPCR Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

For Western blotting, cells were lysed in 1xSDS loading buffer, and after quantification, bromophenol blue was added to a final concentration of 0.1%. 25~30ug of total protein was resolved in 10% Nupage Bis-Tris gel and probed with primary antibodies listed in the Supplementary Table 3.
For RT-qPCR, total RNA was extracted with Trizol (Life Technology) and 10ug/ml of glycogen was used to enhance precipitation of small RNAs. Total RNA was first treated with DNase I (Promega) followed by reverse transcription with the miScript II RT Kit (QIAGEN, 218160, for microRNA analysis) or the SuperScript™ III First-Strand Synthesis System (ThermoFisher, 18080051, for mRNA analysis). RT-qPCR was performed using the miScript SYBR Green PCR Kit (QIAGEN, 218073 for microRNA) or the Luna Universal qPCR Master Mix (NEB, M3003L, for mRNA) on a step-one plus PCR machine (Applied Biosystems). The primers used are listed in Supplementary Table 4.

Qian H., Kang X., Hu J., Zhang D., Liang Z., Meng F., Zhang X., Xue Y., Maimon R., Dowdy S.F., Devaraj N.K., Zhou Z., Mobley W.C., Cleveland D.W, & Fu X.D. (2020). Reversing Parkinson Disease Model with in situ Converted Nigral Neurons. Nature, 582(7813), 550-556.

+ Open protocol

+ Expand

Hippocampal RNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Animals were anesthetized with isoflurane in the animal facility, and eight were killed every 4 h (six time points). The brain was quickly extracted, and the hippocampus was removed and rapidly frozen in liquid nitrogen. The time between decapitation and sample freezing was <1 min to limit RNA degradation. The collection of the hippocampal tissue per time point was <20 min (10 min either side of the hour mark).
Total RNA was extracted from frozen whole hippocampi using the miRNeasy total RNA extraction kit protocol (Qiagen, US) following the manufacturer’s guide and included a DNase digestion step. Samples were stored at −80 °C. All samples were assessed for RNA quality and quantity using a Nanodrop (ThermoScientific, US). Samples sent for RNAseq were further assessed for RNA integrity on the 2200 TapeStation system (Agilent, US). Sequenced samples had >8.0 RIN score.
Each PCR contained 1 µL cDNA, with a total volume of 10 µL. qPCR runs consisted of an initial 95 °C holding stage for 20 s, followed by 40 cycles of 95 °C (1 s) and 60 °C (20 s), followed by a melt curve step, consisting of 40 cycles of 95 °C (15 s) and 60 °C (1 min), with a final denaturing step of 95 °C (15 s) using a StepOnePlus PCR machine (Applied Biosystems, Life Technologies, UK).

Birnie M.T., Claydon M.D., Troy O., Flynn B.P., Yoshimura M., Kershaw Y.M., Zhao Z., Demski-Allen R.C., Barker G.R., Warburton E.C., Bortolotto Z.A., Lightman S.L, & Conway-Campbell B.L. (2023). Circadian regulation of hippocampal function is disrupted with corticosteroid treatment. Proceedings of the National Academy of Sciences of the United States of America, 120(15), e2211996120.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Hepatocyte Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIzol Reagent (Life Technologies) was used to isolate total RNA from the hepatocytes according to the manufacturer’s protocol. TaqMan Reverse Transcription reagent (Applied Biosystems) was used to generate cDNA from total RNA. The proprietary probes for rat Nos2 (Rn00561646_m1), Serpine1 (Rn01481341_m1), Tnf (Rn99999017_m1), Il6 (Rn00561420_m1) and Gapdh (Rn01775763_g1) for Q-PCR were purchased from Life Technologies (Grand Island, NY). Samples were analyzed using a StepOne Plus PCR machine (Applied Biosystems) in duplicates for each set of experiment, and the average values were used for quantification. Gapdh was used as the endogenous control. The comparative C_T method (cycle threshold) was used for quantification of gene expression.

Lakshmanan J., Zhang B., Wright K., Motameni A.T., Jaganathan V., Schultz D.J., Klinge C.M, & Harbrecht B.G. (2019). Tender coconut water suppresses hepatic inflammation by activating AKT and JNK signaling pathways in an in vitro model of sepsis.. Journal of functional foods, 64, 103637.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative RT-PCR analysis was performed on a Step-One Plus PCR machine (Applied Biosystems, Life Technology, Carlsbad, CA, USA) as described previously [35 (link)]. The SYBR green PCR core reagent kit (Applied Biosystems, Life Technology, Carlsbad, CA, USA) was used with gene-specific primers and GAPDH-specific primers as a control. Primers used are summarized in S3 Table.

Kan R., Shuen W.H., Lung H.L., Cheung A.K., Dai W., Kwong D.L., Ng W.T., Lee A.W., Yau C.C., Ngan R.K., Tung S.Y, & Lung M.L. (2015). NF-κB p65 Subunit Is Modulated by Latent Transforming Growth Factor-β Binding Protein 2 (LTBP2) in Nasopharyngeal Carcinoma HONE1 and HK1 Cells. PLoS ONE, 10(5), e0127239.

+ Open protocol

+ Expand

Gene Expression Quantification by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using Quick‐RNA MiniPrep Kit (Zymo Research, Orange, CA) according to the manufacturer's instructions. Reverse transcription was accomplished with 0.45 μg of total RNA using random primers and SuperScript III First‐Strand Synthesis Kit for reverse transcription polymerase chain reaction (RT‐PCR) (ThermoFisher Scientific). qPCR assays were performed in duplicate on a StepOnePlus PCR machine (Applied Biosystems) using SYBR Green PCR Master Mix (Applied Biosystems). Primers were synthesized by Sigma–Aldrich. For each sample, differences in threshold cycle values (ΔCt) were calculated by adjusting the Ct of the gene of interest to the Ct of the reference gene GAPDH.
Primers used were as follows: p21 F (5′‐GACACCACTGGAGGGTGACT‐3′) and p21 R (5′‐CAGGTCCACATGGTCTTCCT‐3′), p53 F (5′‐GCCCAACAACACCAGCTCCT‐3′) and p53 R (5′‐CCTGGGCATCCTTGAGTTCC‐3′), GAPDH F (5′‐CAATGACCCCTTCATTGACC‐3′) and GAPDH R (5′‐GACAAGCTTCCCGTTCTCAG‐3′).

Liu S., Mahairaki V., Bai H., Ding Z., Li J., Witwer K.W, & Cheng L. (2019). Highly Purified Human Extracellular Vesicles Produced by Stem Cells Alleviate Aging Cellular Phenotypes of Senescent Human Cells. Stem Cells (Dayton, Ohio), 37(6), 779-790.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!