Rna 5 pyrophosphohydrolase rpph

The 5′-Rapid Amplification cDNA Ends (RACE) analysis was conducted on the selected putative sRNAs to capture their transcription start sites (TSS). Total RNA (up to 15 μg) of P. ananatis strains grown to high density (OD₆₀₀ = 0.6) was extracted as above mentioned (see the section “RNA Extraction and Transcriptomic Analysis”). The resulting RNA was ligated to 300 pmol of RNA linker: GACGAGCACGAGGACACUGACAUGGAGGAGGGAGUAG AAA in the presence of RNA 5′-pyrophosphohydrolase (RppH) (New England BioLabs, Ipswich, MA, United States) and T4 RNA ligase (New England BioLabs, Ipswich, MA, United States) at 37°C for 4 h. The linker-ligated RNA was purified using Trizol-chloroform (2:1) extraction method, as described by Rio et al. (2010) (link). The resulting RNA was ethanol precipitated and suspended in 10 μl of RNase-free water. The cDNA of linker-ligated RNA was synthesized as previously described (see the section “qRT-PCR Validation of sRNA Expression”) and Gene Specific PCR (GSP) was performed using nested linker and sRNA-specific PCR primers (Table 2). The GSP using genomic DNA was used as a control and resulting bands from 5′-RACE were gel-purified and cloned into pJET1.2 blunt (Thermo Fischer Scientific Baltics UAB, Vilnius, Lithuania) prior to sequencing.

Oligonucleotides were obtained from TsingKe (Beijing, China). DNase I, restriction endonucleases, E. coli inorganic pyrophosphatase, E. coli Poly(A) Polymerase, RNA 5′ Pyrophosphohydrolase (RppH), T4 DNA ligase, NTPs, dNTPs, and RNA purification kits were from New England BioLabs (Ipswich, MA, United States). RNase inhibitor was from Thermo Fisher Scientific (Waltham, MA, United States). PrimeSTAR Max DNA Polymerase and Premix Taq DNA Polymerase, SMARTScribe and ProtoScript II Reverse Transcriptase are were from TAKARA (Shiga, Japan). DNA purification kit was from Axygen (Union City, CA, United States). Ni-NTA resin was from Qiagen (Hilden, Germany). Preparative Superdex S200 for gel filtration was from GE Healthcare (Chicago, IL, United States). Radiolabeled nucleotides were from PerkinElmer (Waltham, MA, United States). 2′-F-dNTPs were from TriLink (San Diego, CA, United States).

Tissue and cell samples were dissolved in Isogen (Nippon gene), and total RNAs were prepared by Direct-zol RNA prep kit (Zymo Research). Although other RNA preparation methods are also applicable, we suggest avoiding RNA degradation to capture full-length RNAs. RNA (500 ng) was treated with 25 U of RNA 5′ pyrophosphohydrolase (RppH, New England Biolab) for 1 h at 37 °C in a 50-μl reaction mixture containing 1× Thermopol buffer (New England Biolab). This procedure freed 5′ cap or triphosphate into monophosphate, which can be later ligated by an RNA ligase. The reaction was stopped by phenol-chloroform extraction and ethanol precipitation. Sequencing libraries were constructed by using NEBNext Small RNA Library Prep kit (New England Biolab) according to manufacturer’s instructions. PCR products were run on a 6% native polyacrylamide gel, and a gel region corresponding to 240–380 bp (an insert size of 113–253 bp) was extracted. DNAs were eluted in 300 μl TE, ethanol precipitated, and dissolved in 20 μl of 0.1× TE. Library concentrations were determined by real-time RCR using the KAPA library quantification kit (KAPA Biosystems) on a StepOnePlus (Thermofisher).