Perifosine krx 0401

HumanTMSB10 cDNA was purchased form (Vigene Biosciences, Shandong, China) and cloned into the pSin-EF2 plasmid (addgene #16578, Cambridge, MA, USA). Knockdown of endogenous TMSB10 was performed by cloning two short hairpin RNA (shRNA) oligonucleotides into the pSUPER-puro-retro vector (OligoEngine, Seattle, WA, USA). The sequences of the two separate shRNA fragments are: RNAi#1: CCGGCCCAGTCGTGATGTGGAGGAACTCGAGTTCCTCCACATCACGACTGGGTTTTTG and RNAi#2: CCGGGCCGACCAAAGAGACCATTGACTCGAGTCAATGGTCTCTTTGGTCGGCTTTTTG (synthesized by Invitrogen). Retroviral production and infection were performed according to Weinberg et al. [18 (link)]. The reporter plasmid for the quantitative detection of forkhead box O (FOXO) transcriptional activity was generated using the pGL3-Enhancer plasmid (Promega, Madison, WI, USA) [19 (link)]. Cells were treated with Perifosine (KRX-0401) (Cell Signaling, Beverly, MA, USA) at the indicated final concentrations (30 μM).

The CISD2 expression construct was generated by subcloning PCR-amplified full-length human CISD2 cDNA into the pMSCV-retro-puro vector (Clontech, Palo Alto, CA) using the forward primer: 5′-GAAGGATCCGCCATGGTGCTGGAGAGCGTGG-3′ and reverse primer: 5′-GCCGAATTCTTATACTTCTTTCTTCTTCAG-3′. For downregulation of CISD2, two human siRNA sequences (RNAi1, CCTGAAAGCATTACCGGGTTCGCTA; RNAi2, CAGGAGATAATGTGGGTCCACTAAT) synthesized by Invitrogen (Carlsbad, CA) were cloned into the pSUPER.retro.puro plasmid (Oligoengine, Seattle, WA) to generate Psuper.retro.CISD2-RNAi. Retroviral production and infection were performed as described previously [27 (link)]. Stable cell lines expressing CISD2 or those with CISD2 silenced were selected using puromycin. The reporter plasmid for quantitatively detecting the transcriptional activity of FOXO was generated using the pGL3-Enhancer plasmid (Promega, Madison, WI, USA) as described previously [28 (link)]. In some experiments, perifosine (KRX-0401) (Cell Signaling, Beverly, MA, USA) dissolved in dimethyl sulfoxide (DMSO), was used to treat cells at indicated final concentrations (30 μM) and times.