Gotaq 2x master mix

Manufactured by Thermo Fisher Scientific

Sourced in United Kingdom

GoTaq 2X master mix is a ready-to-use solution containing Taq DNA polymerase, dNTPs, MgCl2, and reaction buffers optimized for efficient DNA amplification by PCR.

Automatically generated - may contain errors

Lab products found in correlation

Abi 3730 genetic analyzer, by Thermo Fisher Scientific (4 mentions) Seqman pro, by DNASTAR (3 mentions)

Spelling variants of this product

GoTaq Green 2X Master Mix (3 citations)

4 protocols using gotaq 2x master mix

Sanger Sequencing Validation of WES Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Direct Sanger sequencing was performed to validate variants identified by WES for both affected and unaffected family members. Genomic DNA was amplified by PCR using GoTaq 2X master mix (AB gene; Thermo Scientific, Epsom, UK) and WFS1 specific primers (forward primer: 5′ CATCGGCTACTTCCTCTTCC; reverse primer: 5′ AGCAGCTTAAGGCGACAGAG,RP1: forward primer: 5′ ttggggttagaggaagaagg; reverse primer: 5′ cctgagtctgtaattgttggaaaa and NOD2: forward primer: 5′ TCTTTGCCGCGTTCTACCT; reverse primer: 5′ GCCAATGTCACCCACAGAGT) were designed with Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/). PCR conditions were as follows: 94°C for 5 min for the initial denaturation followed by 30 amplification cycles comprising 30 s at 94°C (denaturing), 30 s at 60°C (annealing) and finally 45 s at 72°C (extending). After cleaning, the PCR products were reacted with BigDye Terminator v3.1, they were run on ABI 3730 Genetic Analyzer (both from Applied Biosystems, Foster City, CA, USA) and analysed using SeqMan Pro (V.8.0.2 from DNASTAR) sequence analysis. After validation, the segregation of each variant was performed for all available affected and unaffected family members.

Berry V., Ionides A., Georgiou M., Quinlan R.A, & Michaelides M. (2023). Multimorbidity due to novel pathogenic variants in the WFS1/RP1/NOD2 genes: autosomal dominant congenital lamellar cataract, retinitis pigmentosa and Crohn’s disease in a British family. BMJ Open Ophthalmology, 8(1), e001252.

+ Open protocol

+ Expand

Variant Validation by Sanger Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Direct Sanger sequencing was performed to validate the variant identified by whole exome sequencing. Genomic DNA was amplified by PCR using GoTaq 2X master mix (AB gene; Thermo Scientific, Epsom, UK) and CRYAA, CRYBA1, CRYBB1, CRYGA, CRYGC and CRYGD -specific primers designed with https://bioinfo.ut.ee/primer3-0.4.0/PCR conditions were as follows: 94 °C for 5 min of initial denaturation followed by 30 cycles of amplification of 30 s at 94 °C denaturing, 30 s at 60 °C annealing, and 45 s at 72 °C for extending. After cleaning, the PCR products were reacted with BigDye Terminator v3.1, they were run on ABI 3730 Genetic Analyzer (both from Applied Biosystems, Foster City, CA, USA) and analysed using SeqMan Pro (version 8.0.2 from DNASTAR) sequence analysis. After validating the variant, segregation was performed in all the available family members.

Berry V., Ionides A., Pontikos N., Georgiou M., Yu J., Ocaka L.A., Moore A.T., Quinlan R.A, & Michaelides M. (2020). The genetic landscape of crystallins in congenital cataract. Orphanet Journal of Rare Diseases, 15, 333.

+ Open protocol

+ Expand

Validating Genetic Variants through Sanger Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sanger sequencing was performed to validate the variant identified by whole exome sequencing. Genomic DNA was amplified by PCR using GoTaq 2X master mix (AB gene; Thermo Scientific, Epsom, UK) and PAX6, PITX3 and HSF4 -specific primers designed with http://bioinfo.ut.ee/primer3-0.4.0/ PCR conditions were as follows: 94 °C for 5 min of initial denaturation followed by 30 cycles of amplification of 30 s at 94 °C denaturing, 30 s at 60 °C annealing, and 45 s at 72 °C for extending. After cleaning, the PCR products were reacted with BigDye Terminator v3.1, they were run on ABI 3730 Genetic Analyzer (both from Applied Biosystems, Foster City, CA, USA) and analysed using SeqMan Pro (version 8.0.2 from DNASTAR) sequence analysis. After validating the variant, segregation was performed in all the available family members.
The protein structure of PAX6 and HSF4 were analysed using SWISSMODEL (Fig. 2: A, B).
Wt-PAX6 (https://swissmodel.expasy.org/repository/uniprot/P26367)
Mut-PAX6 (https://swissmodel.expasy.org/interactive/1hpd5p/models/)
Wt-HSF4 (https://swissmodel.expasy.org/interactive/0QmfH7/models/)
Mut-HSF4 (https://swissmodel.expasy.org/interactive/Fx4QGZ/models/)

Berry V., Ionides A., Pontikos N., Moore A.T., Quinlan R.A, & Michaelides M. (2021). Variants in PAX6, PITX3 and HSF4 causing autosomal dominant congenital cataracts. Eye, 36(8), 1694-1701.

+ Open protocol

+ Expand

Validating Variants via Sanger Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sanger sequencing was performed to validate the variant identified by whole exome sequencing. Genomic DNA was amplified by PCR using GoTaq 2X master mix (AB gene; Thermo Scientific, Epsom, UK) and PAX6, PITX3 and HSF4 -specific primers designed with http://bioinfo.ut.ee/primer3-0.4.0/ PCR conditions were as follows: 94 °C for 5 min of initial denaturation followed by 30 cycles of amplification of 30 s at 94 °C denaturing, 30 s at 60 °C annealing, and 45 s at 72 °C for extending. After cleaning, the PCR products were reacted with BigDye Terminator v3.1, they were run on ABI 3730 Genetic Analyzer (both from Applied Biosystems, Foster City, CA, USA) and analysed using SeqMan Pro (version 8.0.2 from DNASTAR) sequence analysis. After validating the variant, segregation was performed in all the available family members.
The protein structure of PAX6 and HSF4 were analysed using SWISSMODEL (Figure 3 and Figure 4). Wt-PAX6 (https://swissmodel.expasy.org/repository/uniprot/P26367); Mut-PAX6 (https://swissmodel.expasy.org/interactive/1hpd5p/models/) Wt-HSF4 (https://swissmodel.expasy.org/interactive/0QmfH7/models/; Mut-HSF4 (https://swissmodel.expasy.org/interactive/Fx4QGZ/models/

Berry V., Ionides A., Pontikos N., Moore A.T., Quinlan R.A., & Michaelides M. (2021). Variants in PAX6, PITX3 and HSF4 Causing Autosomal Dominant Congenital Cataract.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!