Psuperior puro

For forced expression experiments, cDNA encoding for ADAM32 was amplified by PCR using Fast Start Taq DNA Polymerase (Roche, Basel, Switzerland). The amplified fragment was cloned into pcDNA3.1/V5-His (Invitrogen) and p3xFLAG-CMV™-10 Expression Vectors (Sigma-Aldrich, St. Louis, MO, USA). For the Tet-inducible experiment, the region encoding 3xFLAG-ADAM32 (aa20 to aa787) was subcloned into pRetroX-Tight-Pur (Clontech, Mountain View, CA, USA).
For knockdown experiments, pSUPERIOR-puro (OligoEngine, Seattle, WA, USA) was used. Target sequences of shRNA were designed by using siDirect version 2 (http://sidirect2.rnai.jp, accessed on 27 July 2017) according to an established protocol [30 (link)]. The sense and antisense oligos for the target gene were annealed and subcloned into the pSUPERIOR-puro vector according to the manufacturer’s protocol. Table S2 shows the oligo sets and shRNA target sequences used. All constructs were confirmed by sequencing analysis. The shRNA vectors targeting the ADAM32 gene and LacZ are referred to as shADAM32 and shLacZ, respectively. The vector expressing mutant type TP53 (R248W) was constructed in a previous study [31 (link)] and is referred to as pCMX-p53-R248W.

Oligonucleotides targeted to the 5′-untranslated region (UTR) of NSUN2 and METTL1 were synthesized, and were ligated into pSUPERIOR.PURO (OligoEngine, Seattle, WA, USA). Puromycin-resistant colonies (thirty colonies) were cloned in each transfection, and the protein expression of each clone was checked by immunoblot analysis as shown previously [17] (link). Five independent clones that repress expression of endogenous tRNA modifying enzymes were pooled and used as a knockdown clone.

The PTEN (GenBank accession number, NM_000314; AAGACCATAACCCACCACAGC) shRNA target sequences were designed by GeneChem Company (Montreal, Quebec, Canada) (forward, 5′-GACCAUAACCCACCACAGCTT-3′ and reverse, 5′-GCUGUGGUGGGUUAUGGUCTT-3′). The oligonucleotide-annealed products were subcloned into pSUPERIOR.puro (Oligoengine) between the BglII and HindIII sites.
For transfection, ACHN cells were seeded onto a 96-well plate (5×10³ cells/well) and following 24 h, cells were transfected with the indicated shRNA using Lipofectamine 2000 according the manufacturer’s instructions.