Total DNA was extracted from leaves of common wheat using a DNeasy Plant Mini Kit (Qiagen, Germany). To obtain genome-specific primers, we searched for the sequences of all three WPCL1 homoeologues in the chromosome-arm specific survey sequences of 3AL, 3B and 3DL [38 (link)]. First, a blastn search against the survey sequences was performed using the WPCL1 sequences of T. monococcum L. (accession number; AB773826) [25 (link)] as a query. Alignments of the survey sequences obtained from the three genomes led to the design of the following genome-specific primers to amplify the entire coding region: WPCL-A1; 5′-GCTCCAAAATGGGTCCAGAGGA-3′ and 5′- GGACAGTGAGTCCCAAATCTGA -3′ , WPCL-B1, 5′- TGCGCAAATTAAATATCCGACAGA -3′ and 5′- GATCGACACAAACACACGCC -3′ ; WPCL-D1, 5′- ATCTATCCACCATCCATGCG-3′ and 5′- CCGGACAGGACACATTCACA -3′ . Thirty-three cycles of PCR were performed using KAPATaq Extra (Kapa Biosystems, USA) and the following reaction conditions: 30 s at 94°C, 30 s at 60°C, and 4 m at 72°C. Nucleotide sequences were determined with BigDye Terminator version 3.1 (Applied Biosystems, USA) using an Applied Biosystems 3730xl DNA Analyzer. Nucleotide sequences and their predicted amino acid sequences were analyzed by GENETYX-MAC version 12.00 software (Whitehead Institute for Biomedical Research, USA).
Kapa taq extra
Manufactured by Roche
Sourced in United States
KAPA Taq Extra is a DNA polymerase enzyme designed for PCR amplification. It exhibits high processivity and accuracy, and is suitable for a wide range of PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Midori green advance, by Nippon Genetics (2 mentions)
Bigdye terminator version 3, by Thermo Fisher Scientific (1 mentions)
3730xl dna analyzer, by Thermo Fisher Scientific (1 mentions)
Dneasy plant mini kit, by Qiagen (1 mentions)
Loading buffer, by Takara Bio (1 mentions)
Sepasol rna 1 super g, by Nacalai Tesque (1 mentions)
Sc 46, by Fujifilm (1 mentions)
Revertra ace, by Toyobo (1 mentions)
Biometra trio, by Analytik Jena (1 mentions)
Ex taq dna polymerase, by Takara Bio (1 mentions)
Kapa hifi, by Roche (1 mentions)
Amplitaq360, by Thermo Fisher Scientific (1 mentions)
Zero blunt topo pcr cloning kit for sequencing, by Thermo Fisher Scientific (1 mentions)
Veriti 96 well thermal cycler, by Thermo Fisher Scientific (1 mentions)
6 protocols using kapa taq extra
1
Genome-Specific Primer Design for Wheat WPCL1
2
Identification of E. coli by uspA PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Presumptive E. coli were streaked on Brain–Heart Infusion agar (BHI, Difco Laboratories, Detroit, MI, USA) and were incubated overnight at 37 °C. After incubation, a single colony was suspended in 100 µL of sterile distilled water as template DNA for PCR analysis. The primers used for uspA amplification were shown to be gene-specific for E. coli [22 (link)]. The enzyme used for PCR amplification was KAPA Taq Extra (Kapa Biosystems, Nippon Genetics, Tokyo, Japan). The reaction mixture (15 µL) contained 1× KAPA Extra Buffer, 2.5 mM MgCl2, 0.3 mM dNTPs, 0.5 µM each of forward and reverse primers, 0.1 U KAPA Taq Extra DNA polymerase, and 1.0 µL of template DNA. The PCR amplification program used was as follows: initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 2 min, annealing at 70 °C for 1 min, elongation at 72 °C for 1 min. Amplification was confirmed by electrophoretic analysis of a 5 µL aliquot of the reaction product, mixed with 1 µL of 6× Loading Buffer (TAKARA, Tokyo, Japan) on 1.0% agarose gel. The strain NBRC 3301 (E coli; National Institute of Technology and Evaluation, Japan) was used as a positive control for identifying E. coli by PCR analysis.
3
Isolation and Detection of cbsx Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA from wild type and cbsx mutants was prepared using Sepasol®-RNA I Super G (Nakalai tesque, Kyoto, Japan), and cDNA samples were synthesized for 20 min at 42°C by ReverTra Ace® (Toyobo, Osaka, Japan), using oligo(dT)20. The cDNAs from wild type and cbsx mutants were amplified by KAPATaq EXtra (KAPA Biosystems, Wilmington, MA, United States), with the following cycle conditions: 94°C for 2 min, (94°C for 30 s, 55°C for 30 s, and 72°C for 1 min) × 25 cycles. The primers used are listed in Supplementary Table S2 . Amplified samples were electrophoresed and visualized by a combination of a black light and a longpass emission-filter (SC-46, Fujifilm, Tokyo, Japan; Motohashi, 2019 (link)).
4
Genomic PCR Optimization and Verification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic PCR was performed using AmpliTaq 360 (Applied Biosystems), KAPA HiFi, or KAPA Taq Extra (KAPA Biosystems) on a Veriti 96-well Thermal Cycler (Applied Biosystems) or Biometra Trio (Analytik Jena) according to the manufacturer’s instructions. Specific PCR conditions are available upon request.
Primers used to verify gene targeting events are described in Figs.2 and 4 and Supplementary Figs. 10 and 11 , and Supplementary Table 7 and 8 . Sequencing of the junction regions was used to ensure the fidelity of the flanking µH and CRISPR-Cas9 protospacers. PCR products from cassette-excised iPSC clones were sequenced directly, while PCR products from populations were cloned using the Zero Blunt TOPO PCR Cloning Kit for Sequencing (Invitrogen), and then amplified and sequenced from the resulting bacterial colonies with Ex Taq DNA Polymerase (Takara) and T3/T7 primers. Primer design for exons 1–9 of HPRT1 (Accession NG_012329.1) and exons 1-5 of APRT (Accession NG_008013.1) was performed using the NCBI Primer-BLAST with optional settings for human repeat filter, SNP handling, and primer pair specificity checking to H.sapiens (taxid:9606) reference genome, and are listed in Supplementary Table 9 .
Primers used to verify gene targeting events are described in Figs.
5
Mapping QTL for Panicle Weight in Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
From 44 CSSLs, only CSSL512, carrying 10.3 Mb of the "Nona Bokra" homozygous allele, was selected to characterize the QTL effect for the PRL4 position on chromosome 4. After the backcross of CSSL512 with "Koshihikari", the genotypes of 288 BC 1 F 2 plants were analyzed using eight SSR markers (International Rice Genome Sequencing Project, 2005). NIL-PRL4 was selected from 288 BC 1 F 3 plants by genotyping using 13 SSR markers. NIL-PRL4 had 6.6 Mb of the "Nona Bokra" homozygous allele, localized nearest PRL4 marker RM5749 (Fig. 3a). In addition, because the locus for low panicle weight, which was named LPW4 in this study, was identi ed at the nearest marker RM3308 by Ujiie et al. (2012) , NIL-LPW4, carrying 3.2 Mb of "Nona Bokra" homozygous allele between RM7113 and RM3308, was selected from the BC 1 F 3 plants (Supplementary Figure 1a). DNA extraction was conducted using TPS buffer according to Monna et al. (2002) . PCR was carried out using KAPA Taq Extra (Kapa Biosystems, USA), and the PCR pro le was 94°C for 2 min, 35 cycles of 94°C for 30 sec, 55°C for 15 s, 72°C for 30 s, and a nal extension at 72°C for 5 min. The resultant PCR products were visualized using 4% agarose gel stained with Midori Green Advance (Nippon Genetics, Tokyo, Japan).
6
Mapping QTL for Panicle Weight in Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
From 44 CSSLs, only CSSL512, carrying 10.3 Mb of the "Nona Bokra" homozygous allele, was selected to characterize the QTL effect for the PRL4 position on chromosome 4. After the backcross of CSSL512 with "Koshihikari", the genotypes of 288 BC 1 F 2 plants were analyzed using eight SSR markers (International Rice Genome Sequencing Project, 2005). NIL-PRL4 was selected from 288 BC 1 F 3 plants by genotyping using 13 SSR markers. NIL-PRL4 had 6.6 Mb of the "Nona Bokra" homozygous allele, localized nearest PRL4 marker RM5749 (Fig. 3a). In addition, because the locus for low panicle weight, which was named LPW4 in this study, was identi ed at the nearest marker RM3308 by Ujiie et al. (2012) , NIL-LPW4, carrying 3.2 Mb of "Nona Bokra" homozygous allele between RM7113 and RM3308, was selected from the BC 1 F 3 plants (Supplementary Figure 1a). DNA extraction was conducted using TPS buffer according to Monna et al. (2002) . PCR was carried out using KAPA Taq Extra (Kapa Biosystems, USA), and the PCR pro le was 94°C for 2 min, 35 cycles of 94°C for 30 sec, 55°C for 15 s, 72°C for 30 s, and a nal extension at 72°C for 5 min. The resultant PCR products were visualized using 4% agarose gel stained with Midori Green Advance (Nippon Genetics, Tokyo, Japan).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!