Lightcycler 96

Total RNA was isolated using the RNAiso Plus Kit (Takara, catalog no. 9109) according to the manufacturer’s instructions. A total of 1000 ng of mRNA was reverse transcribed into cDNA using the PrimeScript RT Reagent Kit with the genomic DNA Eraser (Takara, catalog no. RR047). Quantitative PCR (qPCR) analysis was performed on a real-time PCR instrument (Roche, LightCycler 96, Basel, Switzerland) using the SYBR Premix Ex Taq (Takara, catalog no. RR420) to detect each of the target genes. The list of qPCR primers used in this study is the following: KRT17-F: CTACAGCCAGTACTACAGGACA, KRT17-R: AACTTGGTGCGGAAGTCATCA. GAPDH-F: CATTGACCTCAACTACATGGTTT, GAPDH-R: GAAGATGGTGATGGGATTTCC. The housekeeping gene human glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was measured as an endogenous control and the relative mRNA expression levels were quantified using the 2-ΔΔCt method. All qRT-PCR experiments were performed in triplicate.

A primer pair RT-F/R (Table 3) was designed to use for analyzing the expression of TaPPH-7A in different wheat genotypes. Quantitative real-time PCR (qRT-PCR) was performed in triplicate with Roche LightCycler® 96 using the SYBR® Premix Ex Taq™ (Tli RNaseH Plus) (Takara, Japan). The qRT-PCR reaction system with specific primer contains 10 μL 2 × SYBR Premix Ex Taq™, 0.4 μL 50 × Rox Reference Dye II, 0.4 μL (5 μM) of each primer (Table 3), 1 μL cDNA template, and 7.8 μL ddH₂O. The reaction procedure was as follows: denaturation at 95 °C for 2 min; followed by 45 cycles at 95 °C for 20 s, 60 °C for 20 s, and 72 °C for 20 s. TaActin was used as the endogenous control of normalizing expression levels of different samples. Gene relative expression levels were calculated using the 2^-△△CT method [63 (link)]. The statistical analysis of ΔΔC_T according to the method described by Zhang et al. [35 (link)].

Total RNA was isolated from cell or tissue samples using a RNAiso Plus kit (Takara; Dalian, China; Catalog no. 9108) according to the manufacturer's instruction. A total of 1 µg RNA was reverse transcribed into cDNA using a PrimeScript RT reagent kit and treated with the gDNA Eraser (Takara; Catalog no. RR047) to remove genomic DNA according to the manufacturer's protocol. qRT‐PCR was performed on a Real‐Time PCR Instrument (Roche LightCycler 96; Switzerland) using the SYBR Premix Ex Taq (Takara; Catalog no. RR420) to detect each of the target genes. The list of qRT‐PCR primers used in this study is available in Table S3, Supporting Information. The following parameters were used for the qRT‐PCR: 95 °C for 10 min followed by 40 cycles at 95 °C for 30 s and 60 °C for 30 s. The results were expressed as a relative mRNA amount using the standard ΔΔCt method. The housekeeping gene glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) was used as the endogenous control to normalize gene expression.

Cell or tissue mRNA was isolated with TRIzol and reverse transcribed into cDNA with M-MLV (Invitrogen). Relative quantitative real-time PCR analysis was performed on Roche LightCycler 96 using the SYBR Premix Ex Taq II (Takara). These data were analyzed using ΔΔC_t method.

Total RNA was extracted from muscle or ZF4 cells using Trizol reagent (Invitrogen, United States) and transcribed to cDNA by PrimeScript^TM RT Reagent Kit (Takara, Japan). The primer sequences for GSK-3β, β-catenin, FAS, CCAAT/enhancer-binding protein α (C/EBPα), and reference gene (β-actin) (Teng et al., 2014 (link)) were listed in Table 2. A quantitative thermal cycle (ROCHE, Lightcycler96, Switzerland) and SYBR^® Premix Ex Taq^TM II (Takara, Japan) were used to carry out real-time PCR. The real-time PCR program was set as follows: 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, and 60°C for 1 min. The amplification efficiency was detected, and the 2^-ΔΔC_T method was employed to analyze the differences of relative gene expression in each sample by using β-actin as the internal reference gene (Livak and Schmittgen, 2001 (link)).