To quantify mRNA transcripts of Pbmdr1, Pbvp2 (PBANKA_132050), Pbvcx1 (PBANKA_010230), Pbggcs (PBANKA_081980) and Pbgst (PBANKA_102390) genes, fresh parasite pellets were prepared and total RNA was extracted from at least 1×106 parasites based on High Pure RNA extraction kit (Roche™). The RNA was immediately used for cDNA synthesis. The first-strand cDNA synthesis was performed in a final volume of 20µl using Transcriptor First Strand cDNA synthesis kit (Roche™) and oligo-dT as primers, briefly 5µg of total RNA, 1µl of oligo-dT (2.5µM) and water were mixed with 4µl of Transcriptor Reverse Transcriptase buffer (5×), 0.5 µl RNase Inhibitor (40U/µl), 2 µl of dNTPs (10mM) and 0.5 µl of Transcriptor Reverse Transcriptase (20U/µl) was added. The RT reaction mix was incubated at 50°C for 60 min, then at 85°C for 5 min and finally chilled on ice. The cDNA was used as template for RT-PCR assays or stored at -15 to -20°C for longer period.
Highpure rna extraction kit
Manufactured by Roche
Sourced in Switzerland
The HighPure RNA extraction kit is a laboratory tool designed for the isolation and purification of high-quality RNA from a variety of biological samples. It utilizes a silica-based membrane technology to capture and purify RNA, allowing for efficient extraction and downstream analysis.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (7 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (4 mentions)
Lightcycler 480 software version 1, by Roche (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Maxima sybr green qpcr master mix, by Thermo Fisher Scientific (2 mentions)
Superscript 2, by Thermo Fisher Scientific (2 mentions)
Quantitect primer assay, by Qiagen (2 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (1 mentions)
Superscript vilo, by Thermo Fisher Scientific (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rt2 first strand kit, by Qiagen (1 mentions)
Rt2 sybr green mastermix, by Qiagen (1 mentions)
Lightcycler 480 instrument, by Roche (1 mentions)
Lightcycler 480 sequence detector, by Roche (1 mentions)
Sybr green, by Roche (1 mentions)
Geneticin g418, by Thermo Fisher Scientific (1 mentions)
Pcdna3.1 expression vector, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Lightcycler 2.0 instrument, by Roche (1 mentions)
Improm 2 reverse transcription kit, by Promega (1 mentions)
16 protocols using highpure rna extraction kit
1
Quantifying Plasmodium Transcripts by RT-PCR
2
Quantitative PCR Analysis of Wnt Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the HighPure RNA extraction kit (Roche) according to the manufacturer`s protocol. Five-hundred ng RNA were reverse transcribed using Superscript II (Thermo Fisher Scientific) and used for subsequent SYBR green-based quantitative PCR (qPCR) following a standard protocol (Applied Biosystems, Carlsbad, CA, USA). Primer sequences can be found in Supplementary Table 1 . PCR conditions were 2 min at 50°C and 10 min at 95°C followed by 40 cycles with 15 s at 95°C and 1 min at 60°C. The melting curve was assessed in the following program: 15 s at 95°C, 1 min at 60°C and 30 s at 95°C. The transcript levels of WNT5A, FZD2, FZD5, FZD6, FZD7, FZD8, ROR2, and RYK (human and mouse) were calculated applying the relative quantification method ΔΔCT [47 (link)] and are presented in x-fold increase relative to the house keeping genes GAPDH or β-actin.
3
Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from cell cultures was isolated using the HighPure RNA extraction kit from Roche Applied Science (Mannheim, Germany) according to the manufacturer’s protocol. RNA (500 ng) was reverse transcribed using Superscript II (Life Technologies, Darmstadt, Germany) and used for SYBR green-based real-time polymerase chain reaction (PCR) using a standard protocol (Applied Biosystems). Primer sequences were: hu glyceraldehyde 3-phosphate dehydrogenase (GAPDH) sense, AGCCACATCGCTCAGACAC; hu GAPDH antisense, GCCCAATACGACCAAATCC; hu Dkk-1 sense, AGCACCTTGGATGGGTATTC; hu DKK-1 antisense, CACACTTGACCTTCTTTCAGGAC; mu ACTB sense, GATCTGGCACCACACCTTCT; mu ACTB antisense, GGGGTGTTGAAGGTCTCAAA; mu ALP sense, CTGGTGGCATCTCGTTATCC; mu ALP antisense, CTACTTGTGTGGCGTGAAGG; and mu OPG sense, CCTTGCCCTGACCACTCTTA; mu OPG antisense, CCTTGCCCTGACCACTCTTA. PCR conditions were 50°C for 2 minutes and 95°C for 10 minutes followed by 40 cycles with 95°C for 15 seconds and 60°C for 1 minute. The melting curve as assessed in the following program: 95°C for 15 seconds, 60°C for 1 minute and 95°C for 30 seconds. The results were calculated applying the ΔΔCT method and are presented as the x-fold increase relative to the housekeeping gene (GAPDH or β-actin) or as a percentage of control.
4
qPCR Gene Expression Analysis in Arabidopsis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA for qPCRs was obtained from 50 Arabidopsis seedlings for each genotype, collected 3 days after light exposure. Samples from three independent biological replicates were frozen in liquid nitrogen and RNA was extracted with TRIzol (Invitrogen), and column-purified with the High Pure RNA extraction kit (Roche Diagnostics). RNA quality was determined with a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies). cDNA was synthesized with the High-Capacity cDNA reverse transcription kit (Applied Biosystems) according to the manufacturer’s instructions. The real-time amplification was monitored with the maxima SYBR green qPCR master mix (Thermo Scientific) on a LightCycler 480 II PCR amplification and detection instrument (Roche diagnostics). For the primer sets used for amplification, see Supplementary Table 4
5
RNA Extraction and Expression Profiling
6
RNA Extraction from Myocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from myocytes (n = 64) using the HighPure RNA extraction kit (Roche) according to the kit protocol. RNA concentration and purity were determined using the Nanodrop® ND1000 spectrophotometer (Thermo Scientific). All RNA samples had concentrations > 40 ng/μl and ratios within the recommended ranges (A260/280 = 1.8–2.0; A260/230 > 1.7). RNA sample integrity was determined using the Agilent Bioanalyzer Eukaryote Total RNA Nano assay (Agilent). 57/64 samples had a RNA integrity number (RIN) > 7 while the remaining 7/64 samples had a RIN ≥5 which is still acceptable for downstream qPCR analysis [12 (link)].
7
RNA Extraction and RT-PCR Analysis of DNA Repair Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using High Pure RNA Extraction kit (Roche, Basel, Switzerland). Reverse transcription was conducted using SuperScript® VILO (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s guidelines. RT-PCR experiments were performed and analysed as described in Cowman et al. (2019) (link). Primer sequences used were as follows: LIG4 Forward: TCCCGTTTTTGACTCCCTGG Reverse: GGCAAGCTCCGTTACCTCTG, ABL Forward: TGGGGCATGTCCTTTCCATC Reverse: GATGTCGGCAGTGACAGTGA, ERCC4 Forward: CTCCCTCGCCGTGTAACAAA Reverse: ACACCAAGATGCCAGTAATTAAATC, FEN1 Forward: GTTCCTGATTGCTGTTCGCC Reverse: ATGCGAATGGTGCGGTAGAA, MSH5 Forward: GTTTGCGAAGGTGTTGCGAA Reverse: GTCTGAGACCTCCTTGCCAC, PARP1 Forward: GCCCTAAAGGCTCAGAACGA Reverse: CTACTCGGTCCAAGATCGCC, UBE2T Forward: ATGTTAGCCACAGAGCCACC Reverse: ACCTAATATTTGAGCTCGCAGGT, WRN Forward: TCACGCTCATTGCTGTGGAT Reverse: CAACGATTGGAACCATTGGCA, PMS2 Forward: AGCACTGCGGTAAAGGAGTT Reverse: CAACCTGAGTTAGGTCGGCA, CYCLOA Forward: GCTTTGGGTCCAGGAATGG Reverse: GTTGTCCACAGTCAGCAATGGT. Cyclophillin A was used as a housekeeping gene.
8
RNA Extraction and qPCR Analysis of Myocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from myocytes using the HighPure RNA extraction kit (Roche) according to the kit protocol. RNA concentration and purity was determined using the Nanodrop® ND1000 spectrophotometer [Thermo Scientific and all ratios were within the recommended ranges (A260/280 = 1.8–2.0; A260/230 > 1.7)]. 400 ng total RNA was reverse transcribed to cDNA using the RT2 First Strand Kit (Qiagen) according to the manufacturer’s specifications. Quantitative PCR was performed on the cDNA samples using proprietary Quantitect primer assays (Qiagen) (RPLP0, HLA-DPB1) and RT2 SYBR Green Mastermix (Qiagen) on the 7900HT Fast Real-Time PCR System (Applied Biosystems). RPLP0 was selected from a panel of 10 reference genes which were screened for their expression stability in myocytes (Nel et al., 2019 (link)). Individual data points were calculated as 2−ΔCq, where ΔCq = target gene Cq – reference gene Cq (Schmittgen and Livak, 2008 (link)).
9
Total RNA Extraction and TGIF2LX Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction was carried out using HighPure RNA Extraction Kit (Roche Diagnostics, Basel, Switzerland) according to the manufacturer’s instructions. Total RNA was stored at -70° C until use. Then, the cDNA was synthesized using 0.5 µg of total RNA as described previously (Akbari et al, 2015; Sheikhzade et al, 2016) and stored at -20°C. Real time RT-PCR was performed to analyze the expression level of TGIF2LX gene in the transfected cells as described previously (Raoofian et al, 2013). The PCR products were elecrophoresed using gel agarose %2, as previously described (Mohebi et al, 2017).
10
FFPE Gene Expression Profiling Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 25 formalin-fixed, paraffin-embedded (FFPE) tissue blocks using the High Pure RNA Extraction Kit (Roche Applied Science) and subjected to gene expression profiling (GEP) as has been described [20 (link)]. For data analysis and classification, we used the DQN algorithm, which is the noncentral trimmed mean of differences between perfect match and mismatch intensities with quantile normalization [21 (link)]. DQN was normalized with beta distribution and a Bayesian model was used to determine the classification probability.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!