Pcdna3.0 plasmid

To generate reporter plasmids containing the p21 promoter with nucleotide alterations at positions −2119 and −809, a p21 promoter sequence comprising nucleotides −2308 to +204 with –2119C/–809G was first cloned from genomic DNA using primer sets: 5′‐CGGGGTACCGTGGCTCTGATTGGCTTTCTG‐3′ (forward) and 5′‐GGAAGATCTGAAACACCTGTGAACGCAGCAC‐3′ (reverse). The polymerase chain reaction (PCR) product was ligated into pGL3‐Basic vector (Promega, Madison, WI) and the resultant reporter construct was used as template to generate three other constructs containing −2119A/−809G, −2119C/−809A, and −2119A/−809A haplotypes, respectively, by using site‐specific mutagenesis. Expression vector containing the full coding domain sequence of LEDGF/p75 gene was constructed using the pcDNA3.0 plasmid (Invitrogen, Carlsbad, CA). All constructs were restriction mapped and sequenced. Two small interference RNAs (siRNAs) targeting nucleotides 1428 to 1448 and nucleotides 1340 to 1360 of human LEDGF/p75 mRNA (NM_033222.3) were synthesized and named as si‐p75‐1 and ‐2, respectively.

The full-length ALK7 cDNA was cloned into the pcDNA3.0 plasmid (Invitrogen Corporation, San Diego, CA, USA) to construct the ALK7-overexpressing plasmid, pcDNA3.0-ALK7. The mammalian expression vector pcDNA3.0 was used as the transfection control. si-ALK7 and si-Nrf2 were obtained from RiboBio Co. Ltd.. HBZY-1 cells were transfected using lipofectamine 2000 (Invitrogen).

The complementary DNAs (cDNAs) encoding plasmids used in developing the TR-FRET-based binding assay (Supplementary Table 1a, b) were constructed in the pcDNA3.0 plasmid (Invitrogen) by PCR. The pcDNA3.0-Derlin-1-HA, pcDNA3.0-Venus-Derlin-1(CT4)-HA, pcDNA3.0-Derlin-1-Flag, pcDNA3.0-Derlin-2-Flag, pcDNA3.0-Derlin-3-Flag, pcDNA3.0-Flag-HRD1, pcDNA3.0-Flag-SOD1^WT, pcDNA3.0-Flag-SOD1^mut, and pcDNA3.0-Flag-SOD1(1-20)-CFP plasmids have been constructed in previous studies^{13 (link),14 (link)}. Transfection was performed using Polyethylenimine-Max (Polysciences) according to the manufacturer’s instructions.