RNA was extracted as described previously (10 (link)) and in SI Appendix . Two hundred fifty nanogram RNA was reversed transcribed using stem-loop Multiplex primer pools (Applied Biosystems). Reverse-transcriptase-specific primers for mmu-miR-335-5p (Applied Biosystems miRNA assay ID 000546), mmu-miR-134-5p (ID 001186), mmu-miR-22-3p (ID 000398), mmu-miR-132-3p (ID 000457), and mmu-miR146a-5p (ID 000468) were used and real-time quantitative PCR performed using TaqMan miRNA assays (Applied Biosystems) on the QuantStudio™ Flex PCR system (Thermo Fisher Scientific). Comparative CT values were measured. MiRNA levels were normalized using U6B (Applied Biosystems miRNA assay ID 001093) or RNU19 (Applied Biosystems miRNA assay ID 001003) expression, and relative fold change in miRNA levels were calculated using the comparative cycle threshold method (2−ΔΔCT). Ago2 immunoprecipitation and small RNA sequencing methods are as described previously (10 (link)) and are detailed in SI Appendix .
Mirna assay
Manufactured by Thermo Fisher Scientific
Sourced in United States
The MiRNA assay is a laboratory tool used for the detection and quantification of micro-RNA (miRNA) molecules. It provides a standardized and efficient method for analyzing miRNA expression levels in biological samples. The assay enables researchers to study the role of miRNA in various biological processes and disease states.
Automatically generated - may contain errors
Lab products found in correlation
Taqman mirna reverse transcription kit, by Thermo Fisher Scientific (7 mentions)
Mirneasy mini kit, by Qiagen (4 mentions)
7500 real time thermocycler, by Thermo Fisher Scientific (3 mentions)
Taqman mirna rt kit, by Thermo Fisher Scientific (2 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (2 mentions)
Multiscribe mirna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Multiscribe reverse transcriptase and random primers, by Thermo Fisher Scientific (1 mentions)
Mirneasy kit, by Qiagen (1 mentions)
Abi 7300 instrument, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Geneamp system 9700, by Thermo Fisher Scientific (1 mentions)
Gene expression assay, by Thermo Fisher Scientific (1 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (1 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions)
Taqman universal master mix 2, by Thermo Fisher Scientific (1 mentions)
Taqman fast advanced master mix, by Thermo Fisher Scientific (1 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
20 protocols using mirna assay
1
Quantification of miRNA Expression
2
RNA Isolation and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from ischemic gastrocnemius tissue samples using the miRNeasy mini kit (Qiagen). Real-time PCR was performed with Applied Biosystems miRNA assays (miRNAs -126, 132, -206, and -92a) on a StepOnePlus device.
3
Quantifying miRNA and mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the miRNEasy kit (Qiagen). Reverse transcription was performed using either Multiscribe reverse transcriptase and random primers (Applied Biosystems, Foster City, CA, USA) to generate cDNA, or the Multiscribe miRNA Reverse Transcription kit (Applied Biosystems) using miRNA-specific primers to produce miRNA. Quantitative PCR was performed using inventoried miRNA assays (Applied Biosystems) with standard ABI protocols and reagents, as previously described [19 (link)]. The fold changes between groups were evaluated using relative quantization (delta Ct method) with b-actin as an endogenous mRNA control and RNU48 as an endogenous miRNA control. All the qPCR analyses were repeated at least three times to confirm differences in the expression levels and only results consistent across all three analyses were considered valid. For the mouse striatum, gene expression of miR-132 was measured. For the mouse cortex, expressions of BAG1 [20 (link)] and SAG1 [21 (link)] were measured.
4
Comprehensive Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA, including miRNA, was extracted using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. The concentrations of RNA were determined using a NanoDrop ND-1000 (NanoDrop), and aliquots of the samples were stored at −80 °C. cDNA was synthesized with the PrimeScript RT Reagent Kit (TaKaRa) using 500 ng of total RNA as the template. qPCR analyses were conducted to quantitate mRNA and lncRNA relative expression using SYBR Premix Ex Taq (TaKaRa) with GAPDH as an internal control. miRNA assays (Applied Biosystems) were used to determine the expression levels of miR-15s after reverse transcription by sequence-specific primers, and U6 small nuclear RNA was used as an internal control. The results of qPCR were defined from the threshold cycle (Ct), and relative expression levels were calculated by using the 2−△△Ct method. PCR was performed using an ABI 7300 instrument (Applied Biosystems). The primers used for reverse transcription and PCR analysis were listed in Supplementary Tables 7 and 8 .
5
Quantitative RT-PCR Analysis of miRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative RT-PCR analysis of individual microRNAs was performed using MiRNA Assays (Applied Biosystems, Foster City, CA). 100 ng total RNA were reverse transcribed using a looped-RT specific primer, 0.15 μl dNTPs (100 mM), 1.0 μl reverse transcriptase MultiScribe (50 U/μl), 1.5 μl 10X buffer, 0.19 μl RNase inhibitor (20 U/μl) and 4.16 μl RNase-free water. Then, diluted retrotranscription reaction (1:15) was mixed with 10 μl master mix TaqMan (Universal PCR Master Mix, No AmpErase UNG, 2X), 7.67 μl RNase free water, and 1.0 μl PCR probe. PCR reaction was performed in a GeneAmp System 9700 (Applied Biosystems) as follows: 95 °C for 10 min, and 40 cycles at 95 °C for 15 s and 60 °C for 1 min. Tests were normalized using RNU44 and RNU48 as control.
6
miRNA and mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNase I–treated total RNA (10 ng) was subjected to miRNA RT-PCR analysis with the TaqMan miRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA), miRNA Assays (Applied Biosystems, Foster City, CA), and a Real-Time Thermocycler 7500 (Applied Biosystems, Foster City, CA). RNU6B was used as the microRNA reference housekeeping gene, and GAPDH was used as the mRNA reference housekeeping gene. The primers used for real-time PCR analysis of mRNA expression are presented in Supplementary Table 3 . The mRNA and microRNA levels in tumours that were higher than the median value were defined as “high”, whereas levels lower than the median value were defined as “low”.
7
Profiling miRNA expression in ischemic muscle
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from ischemic gastrocnemius tissue samples using the miRNeasy mini kit (Qiagen). Real-time PCR was performed with Applied Biosystems miRNA assays (miRNAs -126, 132, -206, and -92a) on a StepOnePlus device.
8
Comprehensive RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cell lysates was isolated using TRI Reagent (Molecular Research Center) and cDNA was prepared with High Capacity RNA-to-cDNA Kit (Life Technologies). For miRNA analysis, reverse transcription was performed using TaqMan® MicroRNA Reverse Transcription Kit (Life Technologies) and miRNA pools were isolated using mirVana™ miRNA Isolation Kit (Life Technologies) as the manufacturer's instructions. Real-time PCR was performed with StepOnePlus Real-Time PCR System (Life Technologies) using TaqMan® Fast Advanced Master Mix (Life Technologies) with Gene Expression Assays (Life Technologies) for gene expression analysis and TaqMan® Universal Master Mix II (Life Technologies) with miRNA assays (Life Technologies) for miRNA analysis. Specific primers for gene expression and miRNA analysis were provided in Supplenentary Table 3 . All procedures were performed in accordance with the MIQE guidelines.
9
Urine EV-RNA Profiling of miRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Urine EV-RNA (50 ng/sample) from 74 patients (Table 1 ) was used for reverse transcriptase, which was performed according to manufactures instruction (Life Technologies). Primers used were miRNA assays from Life Technologies # 4427975 for the mature sequences. For Custom primers, Life Technology primers were ordered, miR-21-5p-isomiR (UAGCUUAUCAGACUGAUGUU) #4398987, miR-375-isomiR (UUUGUUCGUUCGGCUCG CGUG) #4398987, miR-204 isomiR (UUCCCUUU GUCAUCCUAUGCCUG) #440886. RT-PCR was performed using 3 μl of diluted cDNA, according to manufacturer's instruction using Light Cycler (Roche). Analysis on expression data of the selected miRNAs by RT-PCR were performed with SPSS version 20.0 and with edgeR [46 (link)]. The cDNA of control samples was pooled and used as a reference. The data was normalized by ΔCt analysis to reference, after which the values were transformed to natural-log.
10
Quantifying miRNA and mRNA Levels in Lung Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNase I-treated total RNA (10 ng) was subjected to microRNA polymerase chain reaction (PCR) analysis with the TaqMan® miRNA Reverse Transcription (RT) Kit (Life technologies, Foster city, CA), miRNA Assays (Life technologies, Foster city, CA), and a Real-Time Thermocycler 7500 (Life technologies, Foster city, CA). RNU6B was used as the small RNA reference housekeeping gene. The following primer sequences were used for amplifyication of the YAP1 gene: the forward primer, 5'- GCTCTTCAACGCCGTCA-3', and the reverse primer, 5'- AGTACTGGCCTGTCGGGAGT-3'. Bcl-2 gene: the forward primer, 5'- CTGTGGATGACTGAGTACC -3' and the reverse primer, 5'- CAGCCAGGAGAAATCAAAC -3'. Slug gene: the forward primer, 5'-GCCTCCAAAAAGCCAAACTACA-3' and the reverse primer, 5'-AGGATCTCTGGTTGTGGTATGACA-3'. IGF1R gene: the forward primer, 5'- ACGGCAGCCAGAGCATGTAC -3' and the reverse primer, 5'- TGCATCCTTGGAGCATCTGA -3'. Bad gene: the forward primer, 5'- GAGCATCGTTCAGCAGCA-3', and the reverse primer, 5'- CATCCCTTCATCTTCCTCAGT-3'. The miR-630 and YAP1 mRNA levels in lung tumors that were higher than the median value were defined as “high”, while levels lower than the median value were defined as “low”.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!