All in one 5 rt mastermix kit

Total RNA was extracted from the F. oxysporum mycelia and the plants using TRIzol reagent (Invitrogen) according the manufacturer's instructions. Reverse transcription was performed using the All‐In‐One 5× RT MasterMix Kit (Abm). HiPer SYBR Premix EsTaq (Mei5bio, 2× M5) was used for qPCR to analyse the expression pattern. The relative expression of each gene was calculated using the 2^−∆∆Ct method as previously described. All experiments were repeated three times. The primers used in RT‐qPCR are listed in Table S3.

We collected 80 adult ACPs, dissected them with forceps in 0.1 M phosphate-buffered saline (PBS, pH 7.2) under a stereo microscope (Leica, Wetzlar, Germany) and collected guts, salivary glands, testes, ovaries, Malpighian tubules, and remnant tissues. RNA was extracted from each tissue with 4 biological replicates per sample. The concentration of RNA isolated from various organs of ACP was shown in Supplementary Table S2.
First-strand cDNA was synthesized using an All-In-One 5×RT MasterMix kit (abm, Chongqing, China) according to the manufacturer’s instructions. RNA isolated from various organs of the insect was added to 20 µl reactions with 1 µg as a template for reverse transcription. Quantification PCR was performed in 20 µL reactions with 100 ng cDNA using a BlasTaq™ 2×qPCR MasterMix kit (abm, Chongqing, China) and primers (forward primer: AAACAGTGGCGAGGAACGAT, reverse primer: CCACCAAATCCGGTCTGTCA) at concentrations of 0.25 μM according to the manufacturer’s instructions in the CFX96 touch system (Bio-Rad, Berkeley, California, USA). β-Actin of ACP was selected to normalize the DcPLV-expression level.

After total RNA quality control, total RNA was reverse-transcribed into cDNA by using an All-In-One 5× RT MasterMix kit (ABM, Richmond, BC, Canada), and experiments were carried out according to the kit instructions. The RT-qPCR primers of GAPDH, FHIT, and PIAS1 genes were designed using Primer Premier 5.0 software, and the primers were synthesized by Shengong Bioengineering Co., Ltd. (Shanghai, China) The detailed information of RT-qPCR primers is given in Table S4.
Then, RT-qPCR was performed using a TB Green Premix Ex TaqⅡkit (Takara, Shanghai, China); the reaction system of RT-qPCR is shown in Table S5 and the amplified conditions are shown in Table S3.
Finally, the 2^−∆∆Ct method was used to calculate relative gene expression, using the following formula: