Total RNA was extracted from myocardial tissue via the Trizol method (Tiangen Biotech Co., Ltd., Beijing, China). The RNA of each sample was then reverse transcribed into cDNA using Takara RNA PCR Kit (AMV) Ver.3.0 (Takara Biotechnology Co., Ltd., Dalian, China) according to the manufacturer's protocol. The upstream and downstream primers of PKD1, HDAC5, VEGF and β-actin are presented in Table I . The thermocycling conditions for PCR were as follows: 94°C for 5 min, 30 cycles of 95°C for 1 min, 45°C for 1 min and 72°C for 1 min. The reaction product (2 µg) was then electrophoresed using 1% agarose gel, stained with ethidium bromide and visualized using UV. The relative gray scale ratio of PKD1, HDAC5, VEGF and β-actin was analyzed using Image Lab™ software version 2.0 (Bio-Rad Laboratories, Inc., Hercules, CA, USA).
Takara rna pcr kit amv ver 3
Manufactured by Takara Bio
Sourced in Japan, China
The TaKaRa RNA PCR Kit (AMV) Ver.3.0 is a reagent kit for reverse transcription and polymerase chain reaction (RT-PCR) of RNA samples. The kit contains reverse transcriptase, DNA polymerase, and necessary buffers and reagents for the RT-PCR process.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (3 mentions)
Sybr premix ex taqtm, by Takara Bio (2 mentions)
Dnase 1, by Nippon Gene (2 mentions)
Rnase free dnase 1, by Qiagen (2 mentions)
Rneasy plant mini kit, by Qiagen (2 mentions)
Transstart top green qpcr supermix aq131, by Transgene (2 mentions)
Rna extraction kit, by Tiangen Biotech (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Image lab software version 2, by Bio-Rad (1 mentions)
Trizol method, by Tiangen Biotech (1 mentions)
Total rna extraction column, by Favorgen Biotech (1 mentions)
Rnaiso plus kit, by Takara Bio (1 mentions)
7000 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Ex taq dna polymerase, by Takara Bio (1 mentions)
Gfp monoclonal antibody, by Abcam (1 mentions)
Premix ex taq, by Takara Bio (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rnase free dnase 1, by Thermo Fisher Scientific (1 mentions)
Abi prism 7300, by Thermo Fisher Scientific (1 mentions)
Taqman pre developed assay reagent, by Thermo Fisher Scientific (1 mentions)
28 protocols using takara rna pcr kit amv ver 3
1
Myocardial RNA Extraction and Expression Analysis
2
Identification and Crossing of GlbNC-Containing Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GlbNC-containing plants were identified using the allele-specific and GlbNC-MITE specific primer (Shina_S03_UNQ: 5′-CTGACCCAACCAATAATTAAAGC-3′) from the cultivar ‘Harunoibuki’. The GlbNC containing plants were naturally crossed with each other in the isolated environment of a phytotron to avoid cross pollination with other genotypes. The genotype of the GlbNC-homozygous line was confirmed with the allele group-specific primers and the size of PCR amplified products of the coding region.
For RNA experiments, immature seeds of the GlbNC-homozygous line and the ‘Harunoibuki (non GlbNC-homozygous)’ were sampled periodically, frozen in liquid nitrogen, and stored in a freezer at –80°C. Total RNA was extracted with RNAs-ici!-P (Rizo, Japan) and treated with DNaseI that was followed by column purification (Total RNA Extraction Column, Favorgen). RT-PCR was employed with TaKaRa RNA PCR Kit (AMV) Ver. 3.0 (TaKaRa, Japan) using a random 9 mer primer for cDNA synthesis and primers of Fw: MetPoor 0 repeat SP, ATGTCTACGAAGCTCAATCTCTTCATCT and Rv: TAA_3′_0rep_rc, TTAAACGACGTCGTATCTsyCCC for zero-repeat genes; and Fw: BW MetPoor SP, ATGTCAACTAAACTCATACTCTCCTTCT and Rv: TAA 3′ 1A2A3D4A rc, CGGAGCTCTTAAACTATGGAGAAACGCTC for repeat-containing genes of 13S globulin of succeeding PCRs.
For RNA experiments, immature seeds of the GlbNC-homozygous line and the ‘Harunoibuki (non GlbNC-homozygous)’ were sampled periodically, frozen in liquid nitrogen, and stored in a freezer at –80°C. Total RNA was extracted with RNAs-ici!-P (Rizo, Japan) and treated with DNaseI that was followed by column purification (Total RNA Extraction Column, Favorgen). RT-PCR was employed with TaKaRa RNA PCR Kit (AMV) Ver. 3.0 (TaKaRa, Japan) using a random 9 mer primer for cDNA synthesis and primers of Fw: MetPoor 0 repeat SP, ATGTCTACGAAGCTCAATCTCTTCATCT and Rv: TAA_3′_0rep_rc, TTAAACGACGTCGTATCTsyCCC for zero-repeat genes; and Fw: BW MetPoor SP, ATGTCAACTAAACTCATACTCTCCTTCT and Rv: TAA 3′ 1A2A3D4A rc, CGGAGCTCTTAAACTATGGAGAAACGCTC for repeat-containing genes of 13S globulin of succeeding PCRs.
3
Reverse Transcription PCR Analysis of MDR1 and MRP1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using an RNAiso™ Plus kit (Takara Bio, Inc., Shiga, Japan). Total RNA (500 ng) was reverse-transcribed into first-strand cDNA using a Takara RNA PCR kit (AMV Ver. 3.0; Takara Bio, Inc.) according to the manufacturer’s instructions. The following primers were used for amplification: multidrug resistance 1 (MDR1), forward 5′-CCCATCATTGCAATAGCAGG-3′ and reverse 5′-GTT CAAACTTCTGCTCCTGA-3′; MRP1, forward 5′-TGAAGG ACTTCGTGTCAGCC-3′ and reverse 5′-GTCCATGAT GGTGTTGAGCC-3′; β-actin, forward 5′-GCATGGAGTCCT GTGGCAT-3′ and reverse 5′-CTAGAAGCATTTGCG GTGG-3′. The PCR reactions were subjected to the following amplification conditions: denaturation at 94°C for 30 sec, annealing (53°C for MDR1, 57°C for MRP1 and 58°C for β-actin) for 30 sec and extension at 72°C for 30 sec. MDR1 was incubated for 32 cycles, MRP1 for 25 cycles and β-actin for 30 cycles. The PCR products were analyzed by 2% gel electrophoresis.
4
Transcriptional Analysis of Bacterial Chalcone Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The WT strain with DMSO or various concentrations of chalcone was cultured and grown to an OD (600 nm) of 2.5 at 37°C. As described previously (Qiu et al., 2011 (link)), the total RNA from the cultured bacteria was isolated and then reverse transcribed into cDNA using the Takara RNA PCR kit (AMV), ver. 3.0 (Takara, Kyoto, Japan). According to the manufacturer's instructions, the PCR reactions were performed in 25-μl volumes using SYBR Premix Ex Taq TM (Takara). The 7000 Sequence Detection System (Applied Biosystems, Courtaboeuf, France) was used to assess the PCR amplification. All primer pairs used for this assay conformed with a previous study (Qiu et al., 2011 (link)). It is worth noting that the housekeeping gene, gyrBRNA, was used as an endogenous control to normalize the expressional levels between the samples.
5
Reverse transcription-PCR analysis of buckwheat
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For reverse transcription-polymerase chain reaction (RT-PCR) analysis, first-strand cDNA was used as a template, which was synthesized from 1.0 mg of total RNA isolated from the young buckwheat endosperm (white dough stage) using a total RNA isolation kit (RNAs-ici!-R, Rizo, Tsukuba, Japan) and DNaseI (NIPPON GENE, Tokyo, Japan). The RNA was primed with oligo-dT adaptor primers and reverse-transcribed in a total volume of 10 µL, followed by PCR using a TaKaRa RNA PCR Kit (AMV) Ver.3.0 (Takara Bio Inc., Kusatsu, Japan). The above-mentioned coding region primers for g13, along with g14 primers (2SA_g14_N:5ʹ-ACGTACCCGAGAGATGAAGGCTTC-3ʹ and TAA_2SA_g14_Bam:5ʹ-gcggatccTTACACAAAATACCGATTTCCTC-3ʹ) and actin (BW actin Self3 Fwd: 5ʹ-GGCATCACACTTTCTACAATGAGC-3ʹ and BW actin Self3 Rev: 5ʹ-GATATCCACATCACATTTCATGAT-3ʹ) were used. The thermal cycling program was set to 95 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s, and extension for 7 min at 68 °C using Ex Taq DNA polymerase (Takara Bio Inc., Kusatsu, Japan). At least three biological replicates were examined using biologically independent seeds with single technical replicate.
6
Quantitative Gene Expression Analysis with qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For assessing gene expression alterations, quantitative reverse transcription PCR (qRT-PCR) was utilized. Total RNA from PC12 cells was extracted and then reverse-transcribed using the Takara RNA PCR Kit (AMV) Ver 3.0 (TaKaRa Bio Inc., Shiga, Japan). The synthesized cDNA was subjected to PCR amplification using SYBR Green I as the fluorescent dye on an ABI PRISM 7300 real-time PCR system. The thermal cycling conditions were initiated with a denaturation step at 95 °C for 30 s, followed by 45 amplification cycles, each consisting of 95 °C for 10 s (denaturation) and 62 °C for 31 s (annealing/extension). To ensure reproducibility and accuracy, all experiments were performed in duplicate and repeated twice. The specific primer sequences used for each target gene are provided in Table 1 . All primer sequences were validated by BLAST.
7
Spo5-GFP RNA Immunoprecipitation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Diploid cells expressing Spo5-GFP were cultured in MM + N at 30°C for 15 h, shifted to MM-N (0 h, 30°C) and sampled for RNA extraction after 6 h. Detailed conditions for RNA-IP were described previously [48 (link)]. Immunoprecipitated RNA was isolated by phenol-chloroform extraction. For immunoprecipitation, anti-GFP (Roche; GFP monoclonal antibody) and anti-HA (Abcam; 16B12, HA monoclonal antibody) were used. Reverse transcription was performed using the TaKaRa RNA PCR kit (AMV, Ver 3.0; Takara bio).
8
Quantitative PCR Analysis of VEGF Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted from each sample, treated with DNase 1, and purified using a RNeasy Mini Kit according to the manufacturer’s instructions (Qiagen, Valencia, CA). cDNA was generated by reverse transcription of 150 ng of RNA using random hexamer primers and a TaKaRa RNA PCR Kit (AMV) Ver.3.0 (TaKaRa, Shiga, Japan). Real-time quantitative PCR was performed using Premix Ex Taq (TaKaRa) on a 7500 Fast Real-Time PCR System (Life Technologies) with the following primers and probes: for VEGF, 5′-GCA CTG GAC CCT GGC TTT ACT-3′ (forward), 5′-ACT TGA TCA CTT ATG GGA CTT CTG-3′ (reverse), and 5′-CCA TGC CCA GTG GTC CCA GGC TG-3′ (probe); for GAPDH, 5′-CAT CAC TGC CAC CCA GAA GA-3′ (forward), 5′-ATG TTC TGG GCA GCC-3′ (reverse), and 5′-TGG ATG GCC CCT CTG GAA AGC TG-3′ (probe). The cycling protocol entailed incubation at 95 °C for 30 s followed by 40 cycles of 95 °C for 5 s and 60 °C for 34 s. Relative gene expression was calculated using the standard curve method. The VEGF mRNA levels were normalized to those of the housekeeping gene GAPDH. Each sample was run in duplicate, and each real-time PCR was repeated three times.
9
3D-printed PCL/BG and PCL/HyA Scaffolds for hDPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 21 days of hDPSCs culture on 3D-printed PCL/BG and PCL/HyA scaffolds (disc with diameter 5 mm and thickness of 2 mm with pore size of 200 ± 5 µm and 300 ± 5 µm for PCL/HyA and PCL/BG, respectively) with a density of 5 × 105 cells/ well, the total RNA was extracted from samples using a Qiagen RNeasy Mini kit (Qiagen, Seoul, South Korea), and then, converted to complementary DNA (cDNA) with a first-strand cDNA using the TaKaRa RNA PCR Kit (AMV) Ver.3.0 (Takara Bio., San Jose, CA, USA). The differentiation of hDPSCs was monitored by measuring mRNA expression levels of differentiation markers, including osteocalcin (OCN), dentin matrix protein 1 (DMP1), and dentin sialophosphoprotein (DSPP). The selected housekeeping gene was β-actin for all real-time polymerase chain reaction (PCR) runs.
Primer sequences for OCN, DMP 1, DSPP, and β-actin were designed based on published cDNA sequences (Table 1 ). The cells were cultured for a total of 3 weeks, with the differentiation medium being changed every 3–4 days. Each measurement was assessed in triplicate.
Primer sequences for OCN, DMP 1, DSPP, and β-actin were designed based on published cDNA sequences (
10
Quantitative RT-PCR Validation of Microarray
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time reverse transcription (RT)-PCR was used to verify the microarray results. Aliquots of the RNA preparations from the 0.1% G3 PAMAM dendrimer-treated and control samples used in the microarray experiments were saved for quantitative real-time RT-PCR. Total RNA was isolated from cells using the Trizol method. To remove the genomic DNA, extracted RNA was treated with RNase-free DNase I (Ambion, Austin, TX, USA) at 37 °C for 20 min. The samples were either used immediately or stored at −80 °C. The concentration and purity of isolated RNA were determined by the NanoDrop method. RNA was reversely transcribed into cDNA using the Takara RNA PCR kit (AMV) Ver. 3.0 (Takara, Kyoto, Japan) according to the manufacturer′s instructions. The PCR reactions were performed in a 25 μL reaction system with specific primers and cycles (Table 4 ) on a 7000 real-time PCR system using a SYBR green universal PCR master mixture from Applied Biosystems. All the samples were analyzed in triplicate and normalized against 16S rRNA expression. The relative expression levels were determined by the ddCt method described in Applied Biosystems User Bulletin No. 2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!