Quantitative reverse transcription (qRT)-PCR was performed with the iScript reverse transcription and iTaq SYBR Green qPCR kit (BioRad, Hercules, CA) using the BioRad real time PCR system (BioRad). β2 microglobulin controlled for overall cDNA content as a reference gene. The primers used for human β2 microglobulin and Twist1 were previously described12 (link),13 (link),20 (link),34 (link). The primers used for human PDGFB were forward; 5′-CTCGATCCGCTCCTTTGATGA-3′ and reverse; 5′-CGTTGGTGCGGTCTATGAG-3′. The protein levels of human PDGFB in ECs were measured using ELISA (R&D systems) and normalized by the protein levels of total cell lysate. When we measured the PDGFB protein levels in the conditioned media (CM), we normalized the levels by the cell numbers.
Itaq sybr green qpcr kit
Manufactured by Bio-Rad
Sourced in United States
The ITaq SYBR Green qPCR kit is a reagent system for performing quantitative real-time PCR (qPCR) analysis. It contains a pre-mixed solution that includes all the necessary components for qPCR, including a DNA polymerase, SYBR Green I dye, and buffer. The kit is designed to enable sensitive and reliable quantification of DNA targets.
Automatically generated - may contain errors
6 protocols using itaq sybr green qpcr kit
1
Quantitative Analysis of PDGFB Expression
2
Quantifying SLIT2 Gene and Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA isolation was performed using an RNeasy mini kit (Qiagen, Valencia, CA, United States). Quantitative reverse transcription (qRT)-PCR was performed using the iScript reverse transcription and iTaq SYBR Green qPCR kit (Bio-Rad, Hercules, CA, United States) then analyzed using the real-time PCR system (Bio-Rad). β2 microglobulin (B2M) was used for overall cDNA content. The primers used for human B2M and TWIST1 are described before (Mammoto et al., 2018 (link), 2020 (link); Hendee et al., 2021 (link)). Primers for human SLIT2 are forward; AGCCGAGGTTCAAAAACGAGA, reverse; GGCAGTGCAAAACACTACAAGA. The protein levels of human SLIT2 were measured using ELISA (MyBioSource, San Diego, CA, United States).
3
Quantitative RT-PCR Analysis of YAP1, TEAD1, and Tie2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative reverse transcription (qRT)-PCR was performed with the iScript reverse transcription and iTaq SYBR Green qPCR kit (BioRad) using the BioRad real time PCR system. β2 microglobulin controlled for overall cDNA content. The primers for human YAP1, TEAD1, Tie2, and β2 microglobulin were previously described (Mammoto et al., 2009 (link); Mammoto A. et al., 2018 (link); Mammoto T. et al., 2019 (link)). The primers for human CYR61 forward; CATTCCTCTGTGTCCCCAAGAA and reverse; TACTATCCTCGTCACAGACCCA, human ANKRD1 forward; TGATTATGTATGGCGCGGATCT and reverse; GCGAGAGGTCTTGTAGGAGTTC, and human KLF2 forward; GCCCUACCACUGCAACUGGUU and reverse; CCAGUUGCAGUGGUAGGGCUU.
4
Quantitative RT-PCR Analysis of Angiogenic Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative reverse transcription (qRT)-PCR was performed with the iScript reverse transcription and iTaq SYBR Green qPCR kit (BioRad, Hercules, CA) using the BioRad real time PCR system (BioRad). Cyclophilin controlled for overall cDNA content. The primers used for mouse Lrp5, Tie2, Vegfr2, and cyclophilin were previously described [15 (link),33 (link),73 (link)].
5
Quantitative Analysis of P16 and YAP1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using an RNeasy mini kit (Qiagen, Valencia, CA, USA). Quantitative reverse transcription (qRT)-PCR was performed with the iScript reverse transcription and iTaq SYBR Green qPCR kit (BioRad, Hercules, CA) using the BioRad real time PCR system (BioRad). Cyclophilin and β2 microglobulin (B2M) controlled for overall cDNA content. The primers used were human P16INK4A; forward 5′-GATCCAGGTGGGT AGAAGGTC-3′, reverse 5′-CCCCTGCAAACTTCG TCCT-3′; mouse P16Ink4a, forward 5’-CGCAGGTTCT TGGTCACTGT-3′, reverse 5′- TGTTCACGAAAGC CAGAGCG-3′. The primers used for human and mouse YAP1, mouse cyclophilin and human B2M were previously described [9 (link), 23 (link)]. CDC42 activity was measured using the CDC42 pull-down activity assay kit (Cytoskeleton, Denver, CO).
6
Quantitative Analysis of Senescence Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative reverse transcription (qRT)-PCR was performed with the iScript reverse transcription and iTaq SYBR Green qPCR kit (BioRad, Hercules, CA) using the BioRad real time PCR system (BioRad). β2 microglobulin and cyclophilin controlled for overall cDNA content as a reference gene. The primers used for human β2 microglobulin, human TWIST1, mouse Twist1, and mouse cyclophilin were previously described (35 (link), 36 (link), 62 (link), 63 (link)). Human p16INK4A primers, forward; GATCCAGGTGGGTAGAAGGTC, reverse; CCCCTGCAAACTTCGTCCT, human p21 primers, forward; TGTCCGTCAGAACCCATGC, reverse; AAAGTCGAAGTTCCATCGCTC, mouse p16INK4A primers, forward; CGCAGGTTCTTGGTCACTGT, reverse; TGTTCACGAAAGCCAGAGCG, mouse αSMA primers, forward; CCCAGACATCAGGGAGTAATGG, reverse; TCTATCGGATACTTCAGCGTCA, and mouse Pdgfb primers forward; CATCCGCTCCTTTGATCTT, reverse; GTGCTCGGGTCATGTTCAAGT. The protein levels of human PDGFB were measured using ELISA (R&D systems, Minneapolis, MN) and normalized by the protein levels of total cell lysate. Senescence β-galactosidase activity was measured using SA β-gal staining kit (Cell Signaling).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!